Incidental Mutation 'R2232:Nes'
ID240089
Institutional Source Beutler Lab
Gene Symbol Nes
Ensembl Gene ENSMUSG00000004891
Gene Namenestin
SynonymsESTM46
MMRRC Submission 040233-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R2232 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87971078-87980451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87978931 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1499 (I1499N)
Ref Sequence ENSEMBL: ENSMUSP00000088493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090973] [ENSMUST00000160694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090973
AA Change: I1499N

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088493
Gene: ENSMUSG00000004891
AA Change: I1499N

DomainStartEndE-ValueType
Filament 7 313 1.81e-37 SMART
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 470 771 2.37e-7 PROSPERO
internal_repeat_1 614 832 5.41e-11 PROSPERO
internal_repeat_2 851 1174 2.37e-7 PROSPERO
internal_repeat_1 1064 1304 5.41e-11 PROSPERO
low complexity region 1347 1366 N/A INTRINSIC
low complexity region 1426 1438 N/A INTRINSIC
low complexity region 1653 1683 N/A INTRINSIC
low complexity region 1713 1724 N/A INTRINSIC
low complexity region 1741 1760 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160694
AA Change: I1455N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125571
Gene: ENSMUSG00000004891
AA Change: I1455N

DomainStartEndE-ValueType
Pfam:Filament 7 313 3.5e-29 PFAM
low complexity region 439 448 N/A INTRINSIC
internal_repeat_2 456 672 1.06e-5 PROSPERO
internal_repeat_1 470 798 1.21e-11 PROSPERO
internal_repeat_1 807 1134 1.21e-11 PROSPERO
internal_repeat_2 1024 1213 1.06e-5 PROSPERO
low complexity region 1303 1322 N/A INTRINSIC
low complexity region 1382 1394 N/A INTRINSIC
low complexity region 1609 1639 N/A INTRINSIC
low complexity region 1669 1680 N/A INTRINSIC
low complexity region 1697 1716 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a high incidence of embryonic lethality, reduced embryo and birth body size, and fewer neural stem cells and increased apoptosis in the neuroepithelium of the developing neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam1a A C 5: 121,519,732 D499E possibly damaging Het
Adamtsl2 G A 2: 27,103,178 G740E probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap9 G A 5: 4,046,603 V2493I probably damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Asns A G 6: 7,689,316 I62T possibly damaging Het
BC027072 A G 17: 71,749,284 S1133P probably benign Het
Celf3 T A 3: 94,480,259 probably null Het
Cyp4f37 A G 17: 32,634,270 T403A probably benign Het
Dgkd T A 1: 87,929,742 S725R probably benign Het
Dnah5 G A 15: 28,408,417 probably null Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Ghrhr T C 6: 55,385,459 F347S probably damaging Het
Htr2a A T 14: 74,645,029 I152F probably damaging Het
Il17re T C 6: 113,464,800 C219R probably damaging Het
Kansl2 A G 15: 98,524,478 L403S probably damaging Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Lrrk2 A G 15: 91,764,716 K1638E probably benign Het
Mcpt9 A T 14: 56,027,988 C85S probably benign Het
Mindy3 C A 2: 12,404,045 R73M probably benign Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Pigq T C 17: 25,932,209 H322R probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prpf39 C T 12: 65,044,012 R32* probably null Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Pth2r G T 1: 65,336,769 W62L probably damaging Het
Scin T A 12: 40,068,931 K622I probably damaging Het
Serpinb6a T C 13: 33,925,320 K143R probably damaging Het
Ska1 G T 18: 74,197,066 probably null Het
Slc30a8 G T 15: 52,306,564 R62S probably benign Het
Slc8a3 A C 12: 81,315,220 I275S probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
St5 T C 7: 109,557,207 D112G probably benign Het
Sult1c2 G T 17: 53,831,820 T243K probably benign Het
Svil T A 18: 5,046,640 M1K probably null Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Thegl A G 5: 77,059,405 I337V possibly damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc3 T C 16: 94,459,972 S1439P probably benign Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp20 A G 2: 31,018,738 N777S probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in Nes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Nes APN 3 87976254 nonsense probably null
IGL01532:Nes APN 3 87978347 missense possibly damaging 0.54
IGL01544:Nes APN 3 87977964 missense possibly damaging 0.93
IGL02609:Nes APN 3 87977221 missense probably benign 0.33
IGL02877:Nes APN 3 87975661 missense probably benign 0.04
IGL02937:Nes APN 3 87979879 missense probably benign
R0271:Nes UTSW 3 87978642 missense possibly damaging 0.91
R0587:Nes UTSW 3 87978569 missense probably benign 0.08
R0625:Nes UTSW 3 87977172 missense possibly damaging 0.91
R0741:Nes UTSW 3 87978967 missense probably damaging 0.98
R1256:Nes UTSW 3 87976576 missense probably benign
R1630:Nes UTSW 3 87977677 missense probably benign 0.32
R1702:Nes UTSW 3 87975979 missense probably benign 0.04
R1724:Nes UTSW 3 87977441 missense probably benign
R1738:Nes UTSW 3 87976421 nonsense probably null
R1853:Nes UTSW 3 87975807 missense possibly damaging 0.91
R1946:Nes UTSW 3 87978514 missense possibly damaging 0.79
R1971:Nes UTSW 3 87978327 missense possibly damaging 0.81
R2013:Nes UTSW 3 87976678 missense possibly damaging 0.51
R2111:Nes UTSW 3 87977311 missense probably benign 0.04
R2392:Nes UTSW 3 87975943 missense probably benign 0.08
R3548:Nes UTSW 3 87973122 splice site probably benign
R3937:Nes UTSW 3 87971236 missense probably benign 0.02
R4239:Nes UTSW 3 87979359 missense probably damaging 1.00
R4240:Nes UTSW 3 87979359 missense probably damaging 1.00
R4426:Nes UTSW 3 87976042 missense probably damaging 0.96
R4493:Nes UTSW 3 87976813 missense probably damaging 0.96
R4494:Nes UTSW 3 87976813 missense probably damaging 0.96
R4674:Nes UTSW 3 87971795 missense possibly damaging 0.51
R4772:Nes UTSW 3 87976179 missense probably benign 0.02
R4959:Nes UTSW 3 87975676 missense probably damaging 0.99
R4973:Nes UTSW 3 87975676 missense probably damaging 0.99
R5055:Nes UTSW 3 87977214 missense probably benign
R5207:Nes UTSW 3 87978628 missense probably damaging 1.00
R5289:Nes UTSW 3 87978418 missense probably damaging 0.98
R5420:Nes UTSW 3 87977002 missense probably damaging 0.99
R5424:Nes UTSW 3 87978824 missense possibly damaging 0.94
R5697:Nes UTSW 3 87977848 missense probably damaging 0.96
R5940:Nes UTSW 3 87975952 missense probably damaging 0.99
R6661:Nes UTSW 3 87976936 missense probably damaging 0.96
R6905:Nes UTSW 3 87978678 missense probably damaging 0.99
R7087:Nes UTSW 3 87979758 missense probably benign 0.00
R7356:Nes UTSW 3 87977751 missense possibly damaging 0.93
X0019:Nes UTSW 3 87977418 missense probably benign 0.15
X0062:Nes UTSW 3 87977726 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTGAGACTCTGGAATGC -3'
(R):5'- ACTTCAGGTAGAGGCCCAAG -3'

Sequencing Primer
(F):5'- CTCTGGAATGCAAGGGCTG -3'
(R):5'- GGCCCAAGGGAGTAGAGTC -3'
Posted On2014-10-15