Incidental Mutation 'R2232:Thegl'
ID240095
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
MMRRC Submission 040233-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2232 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77059405 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 337 (I337V)
Ref Sequence ENSEMBL: ENSMUSP00000112814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031161
AA Change: I337V

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248
AA Change: I337V

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117880
AA Change: I337V

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248
AA Change: I337V

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam1a A C 5: 121,519,732 D499E possibly damaging Het
Adamtsl2 G A 2: 27,103,178 G740E probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap9 G A 5: 4,046,603 V2493I probably damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Asns A G 6: 7,689,316 I62T possibly damaging Het
BC027072 A G 17: 71,749,284 S1133P probably benign Het
Celf3 T A 3: 94,480,259 probably null Het
Cyp4f37 A G 17: 32,634,270 T403A probably benign Het
Dgkd T A 1: 87,929,742 S725R probably benign Het
Dnah5 G A 15: 28,408,417 probably null Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Ghrhr T C 6: 55,385,459 F347S probably damaging Het
Htr2a A T 14: 74,645,029 I152F probably damaging Het
Il17re T C 6: 113,464,800 C219R probably damaging Het
Kansl2 A G 15: 98,524,478 L403S probably damaging Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Lrrk2 A G 15: 91,764,716 K1638E probably benign Het
Mcpt9 A T 14: 56,027,988 C85S probably benign Het
Mindy3 C A 2: 12,404,045 R73M probably benign Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Nes T A 3: 87,978,931 I1499N possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Pigq T C 17: 25,932,209 H322R probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prpf39 C T 12: 65,044,012 R32* probably null Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Pth2r G T 1: 65,336,769 W62L probably damaging Het
Scin T A 12: 40,068,931 K622I probably damaging Het
Serpinb6a T C 13: 33,925,320 K143R probably damaging Het
Ska1 G T 18: 74,197,066 probably null Het
Slc30a8 G T 15: 52,306,564 R62S probably benign Het
Slc8a3 A C 12: 81,315,220 I275S probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
St5 T C 7: 109,557,207 D112G probably benign Het
Sult1c2 G T 17: 53,831,820 T243K probably benign Het
Svil T A 18: 5,046,640 M1K probably null Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc3 T C 16: 94,459,972 S1439P probably benign Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp20 A G 2: 31,018,738 N777S probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4935:Thegl UTSW 5 77037353 critical splice donor site probably null
R5041:Thegl UTSW 5 77056081 missense probably benign 0.05
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7453:Thegl UTSW 5 77060786 missense probably damaging 1.00
R7703:Thegl UTSW 5 77016597 missense probably benign 0.34
R8534:Thegl UTSW 5 77059478 missense probably damaging 1.00
R8899:Thegl UTSW 5 77037353 critical splice donor site probably null
RF007:Thegl UTSW 5 77016408 small insertion probably benign
RF010:Thegl UTSW 5 77016427 small insertion probably benign
RF014:Thegl UTSW 5 77016400 small insertion probably benign
RF016:Thegl UTSW 5 77016408 small insertion probably benign
RF020:Thegl UTSW 5 77016400 small insertion probably benign
RF028:Thegl UTSW 5 77016401 small insertion probably benign
RF030:Thegl UTSW 5 77016401 small insertion probably benign
RF031:Thegl UTSW 5 77016410 small insertion probably benign
RF033:Thegl UTSW 5 77016405 small insertion probably benign
RF033:Thegl UTSW 5 77016429 small insertion probably benign
RF036:Thegl UTSW 5 77016429 small insertion probably benign
RF037:Thegl UTSW 5 77016421 small insertion probably benign
RF039:Thegl UTSW 5 77016402 small insertion probably benign
RF044:Thegl UTSW 5 77016405 small insertion probably benign
RF046:Thegl UTSW 5 77016403 small insertion probably benign
RF055:Thegl UTSW 5 77016403 small insertion probably benign
RF060:Thegl UTSW 5 77016427 small insertion probably benign
RF063:Thegl UTSW 5 77016426 small insertion probably benign
RF064:Thegl UTSW 5 77016415 small insertion probably benign
Z1176:Thegl UTSW 5 77060794 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTATAGCTGGCGTGGAAC -3'
(R):5'- TTCTGATGACTTTGGCCTAGGC -3'

Sequencing Primer
(F):5'- CCCGTACAGTCCAGTTTGAGTAAG -3'
(R):5'- CCTTGTGGAGGCAAAACAGCATC -3'
Posted On2014-10-15