Incidental Mutation 'R2232:St5'
ID240106
Institutional Source Beutler Lab
Gene Symbol St5
Ensembl Gene ENSMUSG00000031024
Gene Namesuppression of tumorigenicity 5
Synonyms2610305K15Rik, 2010004M01Rik
MMRRC Submission 040233-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R2232 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location109523911-109703605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109557207 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 112 (D112G)
Ref Sequence ENSEMBL: ENSMUSP00000078264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005] [ENSMUST00000207394] [ENSMUST00000207745] [ENSMUST00000208583]
Predicted Effect probably benign
Transcript: ENSMUST00000077909
AA Change: D112G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: D112G

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079282
AA Change: D112G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: D112G

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084738
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168005
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207394
Predicted Effect probably benign
Transcript: ENSMUST00000207745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208557
Predicted Effect probably benign
Transcript: ENSMUST00000208583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208981
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam1a A C 5: 121,519,732 D499E possibly damaging Het
Adamtsl2 G A 2: 27,103,178 G740E probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap9 G A 5: 4,046,603 V2493I probably damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Asns A G 6: 7,689,316 I62T possibly damaging Het
BC027072 A G 17: 71,749,284 S1133P probably benign Het
Celf3 T A 3: 94,480,259 probably null Het
Cyp4f37 A G 17: 32,634,270 T403A probably benign Het
Dgkd T A 1: 87,929,742 S725R probably benign Het
Dnah5 G A 15: 28,408,417 probably null Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Ghrhr T C 6: 55,385,459 F347S probably damaging Het
Htr2a A T 14: 74,645,029 I152F probably damaging Het
Il17re T C 6: 113,464,800 C219R probably damaging Het
Kansl2 A G 15: 98,524,478 L403S probably damaging Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Lrrk2 A G 15: 91,764,716 K1638E probably benign Het
Mcpt9 A T 14: 56,027,988 C85S probably benign Het
Mindy3 C A 2: 12,404,045 R73M probably benign Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Nes T A 3: 87,978,931 I1499N possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Pigq T C 17: 25,932,209 H322R probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prpf39 C T 12: 65,044,012 R32* probably null Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Pth2r G T 1: 65,336,769 W62L probably damaging Het
Scin T A 12: 40,068,931 K622I probably damaging Het
Serpinb6a T C 13: 33,925,320 K143R probably damaging Het
Ska1 G T 18: 74,197,066 probably null Het
Slc30a8 G T 15: 52,306,564 R62S probably benign Het
Slc8a3 A C 12: 81,315,220 I275S probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
Sult1c2 G T 17: 53,831,820 T243K probably benign Het
Svil T A 18: 5,046,640 M1K probably null Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Thegl A G 5: 77,059,405 I337V possibly damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc3 T C 16: 94,459,972 S1439P probably benign Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp20 A G 2: 31,018,738 N777S probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in St5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:St5 APN 7 109527708 missense possibly damaging 0.71
IGL01132:St5 APN 7 109570005 unclassified probably null
IGL01288:St5 APN 7 109539822 missense probably damaging 0.96
IGL01645:St5 APN 7 109527634 nonsense probably null
IGL01714:St5 APN 7 109570062 missense probably damaging 0.99
IGL02021:St5 APN 7 109557372 missense probably damaging 1.00
IGL02302:St5 APN 7 109525331 missense probably damaging 1.00
IGL02496:St5 APN 7 109556235 missense possibly damaging 0.83
IGL02795:St5 APN 7 109556364 missense probably damaging 1.00
FR4340:St5 UTSW 7 109556921 unclassified probably benign
FR4737:St5 UTSW 7 109556921 unclassified probably benign
PIT4466001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4469001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4472001:St5 UTSW 7 109531130 missense probably damaging 1.00
R0024:St5 UTSW 7 109524659 missense probably damaging 1.00
R0124:St5 UTSW 7 109542511 missense possibly damaging 0.66
R0125:St5 UTSW 7 109556338 missense probably benign 0.19
R0365:St5 UTSW 7 109538949 missense probably damaging 1.00
R0491:St5 UTSW 7 109557204 missense probably benign 0.45
R0534:St5 UTSW 7 109541428 missense probably damaging 1.00
R0662:St5 UTSW 7 109557426 missense probably damaging 1.00
R0743:St5 UTSW 7 109557345 missense probably damaging 1.00
R0772:St5 UTSW 7 109542320 splice site probably null
R0774:St5 UTSW 7 109542320 splice site probably null
R0787:St5 UTSW 7 109525620 missense possibly damaging 0.94
R0884:St5 UTSW 7 109557345 missense probably damaging 1.00
R1518:St5 UTSW 7 109557355 missense probably damaging 1.00
R1908:St5 UTSW 7 109525326 nonsense probably null
R1909:St5 UTSW 7 109525326 nonsense probably null
R2358:St5 UTSW 7 109556446 missense probably benign 0.01
R2847:St5 UTSW 7 109525337 missense probably damaging 1.00
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2873:St5 UTSW 7 109557430 missense probably benign 0.01
R2874:St5 UTSW 7 109557430 missense probably benign 0.01
R4534:St5 UTSW 7 109531156 missense probably damaging 1.00
R4536:St5 UTSW 7 109531156 missense probably damaging 1.00
R4559:St5 UTSW 7 109525578 missense probably damaging 1.00
R4798:St5 UTSW 7 109557033 missense probably damaging 0.99
R4846:St5 UTSW 7 109556836 nonsense probably null
R5110:St5 UTSW 7 109542490 missense probably benign 0.02
R5181:St5 UTSW 7 109556790 missense probably benign
R5268:St5 UTSW 7 109557312 missense probably benign
R5403:St5 UTSW 7 109556905 missense probably damaging 1.00
R5836:St5 UTSW 7 109541345 missense possibly damaging 0.78
R5932:St5 UTSW 7 109570016 missense probably damaging 1.00
R5937:St5 UTSW 7 109557271 missense possibly damaging 0.86
R6180:St5 UTSW 7 109556888 missense probably benign 0.11
R6741:St5 UTSW 7 109545097 missense possibly damaging 0.95
R6781:St5 UTSW 7 109525304 missense possibly damaging 0.83
R7086:St5 UTSW 7 109525574 missense probably damaging 1.00
R7466:St5 UTSW 7 109525346 missense probably damaging 1.00
R7644:St5 UTSW 7 109556793 nonsense probably null
RF062:St5 UTSW 7 109556946 unclassified probably benign
X0067:St5 UTSW 7 109556240 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGACTCATCCTGGGTGAAG -3'
(R):5'- GTGACAGTGAAACCTCAGCCTG -3'

Sequencing Primer
(F):5'- ATCCTGGGTGAAGCCTCTC -3'
(R):5'- TGAAACCTCAGCCTGCAGGTAC -3'
Posted On2014-10-15