Incidental Mutation 'R0184:Sf3b2'
ID 24011
Institutional Source Beutler Lab
Gene Symbol Sf3b2
Ensembl Gene ENSMUSG00000024853
Gene Name splicing factor 3b, subunit 2
Synonyms 145kDa, 2610311M13Rik, 2810441F20Rik, SF3b150, SF3b145, B230398H18Rik, SAP145, SF3b1
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R0184 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 5273923-5295455 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5283672 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 633 (I633F)
Ref Sequence ENSEMBL: ENSMUSP00000025774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025774]
AlphaFold Q3UJB0
Predicted Effect probably damaging
Transcript: ENSMUST00000025774
AA Change: I633F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025774
Gene: ENSMUSG00000024853
AA Change: I633F

low complexity region 6 22 N/A INTRINSIC
SAP 24 58 1.84e-4 SMART
low complexity region 91 132 N/A INTRINSIC
coiled coil region 140 178 N/A INTRINSIC
low complexity region 201 221 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
low complexity region 264 280 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
low complexity region 408 437 N/A INTRINSIC
Pfam:DUF382 453 579 2.9e-63 PFAM
PSP 584 642 9.41e-33 SMART
low complexity region 693 717 N/A INTRINSIC
low complexity region 745 756 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 2 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 2 associates with pre-mRNA upstream of the branch site at the anchoring site. Subunit 2 also interacts directly with subunit 4 of the splicing factor 3b complex. Subunit 2 is a highly hydrophilic protein with a proline-rich N-terminus and a glutamate-rich stretch in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rln1 T A 19: 29,331,936 K148* probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Sf3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Sf3b2 APN 19 5279587 missense probably benign 0.00
IGL01737:Sf3b2 APN 19 5279838 splice site probably benign
IGL02205:Sf3b2 APN 19 5283737 missense probably benign 0.01
R0370:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0371:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0372:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0373:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0375:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R1606:Sf3b2 UTSW 19 5287998 missense probably benign 0.00
R1609:Sf3b2 UTSW 19 5295033 unclassified probably benign
R2566:Sf3b2 UTSW 19 5275090 missense possibly damaging 0.92
R5163:Sf3b2 UTSW 19 5275137 missense probably damaging 1.00
R6208:Sf3b2 UTSW 19 5275098 missense possibly damaging 0.82
R6275:Sf3b2 UTSW 19 5283650 missense probably damaging 1.00
R6644:Sf3b2 UTSW 19 5279964 splice site probably null
R6986:Sf3b2 UTSW 19 5279895 missense probably benign
R7007:Sf3b2 UTSW 19 5274517 missense probably benign 0.13
R8428:Sf3b2 UTSW 19 5287214 missense possibly damaging 0.52
R8677:Sf3b2 UTSW 19 5286229 missense probably damaging 0.99
R9041:Sf3b2 UTSW 19 5274844 missense possibly damaging 0.47
Z1177:Sf3b2 UTSW 19 5274950 missense probably benign 0.06
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcaaggacagccaggaatatac -3'
Posted On 2013-04-16