Incidental Mutation 'R2232:Gal3st1'
ID 240113
Institutional Source Beutler Lab
Gene Symbol Gal3st1
Ensembl Gene ENSMUSG00000049721
Gene Name galactose-3-O-sulfotransferase 1
Synonyms GalCer sulfotransferase, Gcst, Cst, galactosylceramide sulfotransferase, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase
MMRRC Submission 040233-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2232 (G1)
Quality Score 214
Status Not validated
Chromosome 11
Chromosomal Location 3983636-3999326 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3998282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 163 (I163T)
Ref Sequence ENSEMBL: ENSMUSP00000105608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063004] [ENSMUST00000078757] [ENSMUST00000109981]
AlphaFold Q9JHE4
Predicted Effect probably benign
Transcript: ENSMUST00000063004
AA Change: I163T

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058348
Gene: ENSMUSG00000049721
AA Change: I163T

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078757
AA Change: I163T

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077815
Gene: ENSMUSG00000049721
AA Change: I163T

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109981
AA Change: I163T

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105608
Gene: ENSMUSG00000049721
AA Change: I163T

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121403
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfonation, an important step in the metabolism of many drugs, xenobiotics, hormones, and neurotransmitters, is catalyzed by sulfotransferases. This gene encodes galactosylceramide sulfotransferase, which catalyzes the sulfation of membrane glycolipids including the final step in the synthesis of sulfatide, a major lipid component of the myelin sheath. This gene exhibits elevated expression in ovarian epithelial carcinoma and the encoded enzyme exhibits elevated activity in renal cell carcinoma. Mutations in this gene may be associated with reduced insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hindlimb weakness and progressive ataxia beginning at six weeks of age. Homozygous males exhibit sterility with a block in spermatogenesis prior to the first meiotic division. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam1a A C 5: 121,519,732 D499E possibly damaging Het
Adamtsl2 G A 2: 27,103,178 G740E probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap9 G A 5: 4,046,603 V2493I probably damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Asns A G 6: 7,689,316 I62T possibly damaging Het
BC027072 A G 17: 71,749,284 S1133P probably benign Het
Celf3 T A 3: 94,480,259 probably null Het
Cyp4f37 A G 17: 32,634,270 T403A probably benign Het
Dgkd T A 1: 87,929,742 S725R probably benign Het
Dnah5 G A 15: 28,408,417 probably null Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Ghrhr T C 6: 55,385,459 F347S probably damaging Het
Htr2a A T 14: 74,645,029 I152F probably damaging Het
Il17re T C 6: 113,464,800 C219R probably damaging Het
Kansl2 A G 15: 98,524,478 L403S probably damaging Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Lrrk2 A G 15: 91,764,716 K1638E probably benign Het
Mcpt9 A T 14: 56,027,988 C85S probably benign Het
Mindy3 C A 2: 12,404,045 R73M probably benign Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Nes T A 3: 87,978,931 I1499N possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Pigq T C 17: 25,932,209 H322R probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prpf39 C T 12: 65,044,012 R32* probably null Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Pth2r G T 1: 65,336,769 W62L probably damaging Het
Scin T A 12: 40,068,931 K622I probably damaging Het
Serpinb6a T C 13: 33,925,320 K143R probably damaging Het
Ska1 G T 18: 74,197,066 probably null Het
Slc30a8 G T 15: 52,306,564 R62S probably benign Het
Slc8a3 A C 12: 81,315,220 I275S probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
St5 T C 7: 109,557,207 D112G probably benign Het
Sult1c2 G T 17: 53,831,820 T243K probably benign Het
Svil T A 18: 5,046,640 M1K probably null Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Thegl A G 5: 77,059,405 I337V possibly damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc3 T C 16: 94,459,972 S1439P probably benign Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp20 A G 2: 31,018,738 N777S probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in Gal3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gal3st1 APN 11 3999070 utr 3 prime probably benign
IGL01010:Gal3st1 APN 11 3996914 utr 5 prime probably benign
IGL01079:Gal3st1 APN 11 3998564 missense probably damaging 1.00
IGL01306:Gal3st1 APN 11 3998405 missense probably damaging 1.00
IGL01614:Gal3st1 APN 11 3998996 missense probably damaging 1.00
IGL01990:Gal3st1 APN 11 3998741 missense probably damaging 1.00
IGL02439:Gal3st1 APN 11 3998110 missense possibly damaging 0.95
R0306:Gal3st1 UTSW 11 3998546 missense probably damaging 1.00
R1075:Gal3st1 UTSW 11 3998509 missense possibly damaging 0.80
R1171:Gal3st1 UTSW 11 3998931 missense probably damaging 1.00
R1874:Gal3st1 UTSW 11 3998231 missense probably damaging 1.00
R2230:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2231:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2985:Gal3st1 UTSW 11 3998618 missense probably damaging 1.00
R3552:Gal3st1 UTSW 11 3998110 missense possibly damaging 0.90
R6737:Gal3st1 UTSW 11 3998903 missense probably benign 0.00
R7027:Gal3st1 UTSW 11 3999002 missense probably damaging 0.96
R7106:Gal3st1 UTSW 11 3998509 missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3998609 missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3998651 missense probably damaging 0.98
R7290:Gal3st1 UTSW 11 3998093 missense possibly damaging 0.70
R7438:Gal3st1 UTSW 11 3998227 missense probably benign 0.00
R7934:Gal3st1 UTSW 11 3998405 missense probably damaging 1.00
R9046:Gal3st1 UTSW 11 3998278 missense probably benign 0.05
R9475:Gal3st1 UTSW 11 3998660 missense probably damaging 1.00
RF020:Gal3st1 UTSW 11 3998153 missense possibly damaging 0.75
Z1088:Gal3st1 UTSW 11 3997984 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTCCCCAATGGCCGAAAC -3'
(R):5'- GTCGAAGTACTCCTGCAGTAG -3'

Sequencing Primer
(F):5'- TGGCCGAAACGACTTCC -3'
(R):5'- GGTCCAGGCTACTATCATAGC -3'
Posted On 2014-10-15