Incidental Mutation 'R0184:Rln1'
ID24013
Institutional Source Beutler Lab
Gene Symbol Rln1
Ensembl Gene ENSMUSG00000039097
Gene Namerelaxin 1
Synonymsrlx
MMRRC Submission 038449-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0184 (G1)
Quality Score199
Status Validated (trace)
Chromosome19
Chromosomal Location29331170-29334670 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 29331936 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 148 (K148*)
Ref Sequence ENSEMBL: ENSMUSP00000043376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044143]
Predicted Effect probably null
Transcript: ENSMUST00000044143
AA Change: K148*
SMART Domains Protein: ENSMUSP00000043376
Gene: ENSMUSG00000039097
AA Change: K148*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IlGF 33 185 6.34e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182039
Meta Mutation Damage Score 0.9645 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.9%
Validation Efficiency 66% (50/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In humans there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3, where RLN1 and RLN2 share high sequence homology. The protein encoded by this gene is synthesized as a single-chain polypeptide but the active form consists of an A chain and a B chain linked by disulfide bonds. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. [provided by RefSeq, Jan 2013]
PHENOTYPE: Inactivation of this locus is compatible with fertility but not normal mammary gland development. Postpartum, homozygous mutant females exhibit slight nipples that are insufficient for suckling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C A 3: 124,419,250 V131F probably damaging Het
Adam28 T C 14: 68,637,373 D285G probably benign Het
Akr1c13 A G 13: 4,194,056 E36G probably damaging Het
Antxr2 A G 5: 97,980,030 L214S probably damaging Het
Arhgap26 T A 18: 38,617,673 D46E unknown Het
Armc9 T C 1: 86,198,370 L61P probably damaging Het
Bicc1 C A 10: 71,079,215 R73L probably benign Het
Calm2 T C 17: 87,435,841 N43S probably benign Het
Cct7 A G 6: 85,461,554 D105G probably null Het
Cdk18 T C 1: 132,118,538 N215D probably benign Het
Cep126 T C 9: 8,103,395 T205A probably benign Het
Cfap57 A T 4: 118,599,012 I495N probably damaging Het
Cyp2b9 T A 7: 26,187,007 C152* probably null Het
Dab2ip G A 2: 35,718,791 R579H probably damaging Het
Dnah8 T C 17: 30,683,683 V905A probably benign Het
Eif4h C A 5: 134,625,375 D134Y possibly damaging Het
Espl1 T A 15: 102,299,216 S372T probably benign Het
Fat2 T A 11: 55,296,288 H1244L probably damaging Het
Fbxo11 T A 17: 88,008,673 N443I probably benign Het
Git2 G A 5: 114,739,037 T128M possibly damaging Het
Gm10985 T A 3: 53,845,258 Y21N probably damaging Het
Gm12790 A T 4: 101,967,614 Y152* probably null Het
Heatr5a T C 12: 51,909,969 D1115G probably benign Het
Hipk2 T C 6: 38,718,931 N726S possibly damaging Het
Hrg T C 16: 22,953,771 probably null Het
Iars T G 13: 49,722,212 S792A probably benign Het
Igf1r A G 7: 68,226,193 N1301S possibly damaging Het
Il22 A T 10: 118,205,606 I75F probably damaging Het
Ilkap T C 1: 91,376,305 probably benign Het
Ints13 A T 6: 146,555,044 Y435N probably benign Het
Ints8 A C 4: 11,218,637 S797A probably benign Het
Itgad T A 7: 128,189,231 D405E probably benign Het
Itgam A T 7: 128,086,058 I448F probably damaging Het
Klk1 C T 7: 44,228,749 T41I possibly damaging Het
Mcrip1 T C 11: 120,544,884 M1V probably null Het
Mdga1 A G 17: 29,852,442 Y128H probably damaging Het
Mtor G T 4: 148,464,971 R604L probably benign Het
Olfr1170 A T 2: 88,224,780 L84* probably null Het
Olfr656 T C 7: 104,618,240 V187A probably damaging Het
Pcdhb7 T A 18: 37,343,390 D526E probably benign Het
Pip4k2a T C 2: 18,889,128 D139G probably damaging Het
Pkp3 A C 7: 141,088,367 N536T probably benign Het
Pla2g4c T A 7: 13,356,220 S524T probably benign Het
Pno1 T C 11: 17,211,127 E69G probably benign Het
Pold1 C T 7: 44,541,715 V231M probably benign Het
Poli A G 18: 70,522,731 S248P probably damaging Het
Ppox C T 1: 171,279,552 S138N probably damaging Het
Psg20 T C 7: 18,685,976 E6G probably null Het
Rbmx C T X: 57,391,566 probably null Het
Rnf213 C T 11: 119,414,521 T526I probably damaging Het
Rps6kc1 A T 1: 190,799,093 V904E probably null Het
Sf3b2 T A 19: 5,283,672 I633F probably damaging Het
Sfswap T A 5: 129,507,189 I189N probably damaging Het
Smarca2 T A 19: 26,692,249 Y973* probably null Het
Spink5 G A 18: 44,003,198 D559N probably benign Het
Spty2d1 C T 7: 46,997,574 V536I possibly damaging Het
Tbx3 T C 5: 119,675,562 I221T probably damaging Het
Tcf20 T A 15: 82,852,300 D1650V probably damaging Het
Thsd7b A G 1: 129,430,964 K45R probably benign Het
Tirap A G 9: 35,189,194 S65P probably benign Het
Trim25 C T 11: 88,999,640 P51L probably damaging Het
Trim61 T C 8: 65,014,417 N64S probably benign Het
Twf1 T A 15: 94,581,067 probably null Het
Ubr4 A C 4: 139,445,262 T1692P probably damaging Het
Usp3 A G 9: 66,562,581 M86T probably damaging Het
Utrn T C 10: 12,667,618 D1762G probably benign Het
V1rd19 T A 7: 24,003,207 F33I probably benign Het
Vmn2r52 T C 7: 10,159,338 S625G probably damaging Het
Vmn2r90 G A 17: 17,726,877 W472* probably null Het
Vrk2 C A 11: 26,550,046 A56S probably damaging Het
Yeats2 C T 16: 20,203,685 P620S possibly damaging Het
Zbtb21 C T 16: 97,950,513 D171N probably damaging Het
Zeb1 A T 18: 5,766,808 I440F probably damaging Het
Zfp292 A G 4: 34,819,563 I253T probably damaging Het
Other mutations in Rln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Rln1 APN 19 29332014 missense possibly damaging 0.84
IGL01607:Rln1 APN 19 29331860 missense probably benign 0.02
IGL02415:Rln1 APN 19 29334398 missense probably damaging 0.97
R1670:Rln1 UTSW 19 29332068 missense possibly damaging 0.95
R1965:Rln1 UTSW 19 29334595 start codon destroyed probably null 0.53
R4434:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R4437:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R4438:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R5525:Rln1 UTSW 19 29334520 missense probably benign 0.44
R6484:Rln1 UTSW 19 29334502 missense probably benign
R6648:Rln1 UTSW 19 29332121 missense probably benign 0.28
R7624:Rln1 UTSW 19 29332099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAAGAATGCATGTGAACACTGGAC -3'
(R):5'- GAGCCTTGGTAAGATCGTAGCAGTC -3'

Sequencing Primer
(F):5'- GACTGGTGGTACACAATTAGCTC -3'
(R):5'- ATGCAGAGCCTTTCGATACG -3'
Posted On2013-04-16