Incidental Mutation 'R2232:Kansl2'
ID240133
Institutional Source Beutler Lab
Gene Symbol Kansl2
Ensembl Gene ENSMUSG00000022992
Gene NameKAT8 regulatory NSL complex subunit 2
Synonyms2310037I24Rik
MMRRC Submission 040233-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R2232 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98517658-98534264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98524478 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 403 (L403S)
Ref Sequence ENSEMBL: ENSMUSP00000155089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023727] [ENSMUST00000116400] [ENSMUST00000230542] [ENSMUST00000231066]
Predicted Effect probably benign
Transcript: ENSMUST00000023727
SMART Domains Protein: ENSMUSP00000023727
Gene: ENSMUSG00000022992

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 27 93 4.8e-19 PFAM
Pfam:zf-C3Hc3H 300 365 4.6e-19 PFAM
low complexity region 408 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084005
Predicted Effect probably benign
Transcript: ENSMUST00000116400
SMART Domains Protein: ENSMUSP00000112101
Gene: ENSMUSG00000022992

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 28 92 1e-19 PFAM
Pfam:zf-C3Hc3H 302 364 1.7e-16 PFAM
low complexity region 442 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229818
Predicted Effect probably damaging
Transcript: ENSMUST00000230542
AA Change: L403S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000231066
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam1a A C 5: 121,519,732 D499E possibly damaging Het
Adamtsl2 G A 2: 27,103,178 G740E probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap9 G A 5: 4,046,603 V2493I probably damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Asns A G 6: 7,689,316 I62T possibly damaging Het
BC027072 A G 17: 71,749,284 S1133P probably benign Het
Celf3 T A 3: 94,480,259 probably null Het
Cyp4f37 A G 17: 32,634,270 T403A probably benign Het
Dgkd T A 1: 87,929,742 S725R probably benign Het
Dnah5 G A 15: 28,408,417 probably null Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Ghrhr T C 6: 55,385,459 F347S probably damaging Het
Htr2a A T 14: 74,645,029 I152F probably damaging Het
Il17re T C 6: 113,464,800 C219R probably damaging Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Lrrk2 A G 15: 91,764,716 K1638E probably benign Het
Mcpt9 A T 14: 56,027,988 C85S probably benign Het
Mindy3 C A 2: 12,404,045 R73M probably benign Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Nes T A 3: 87,978,931 I1499N possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Pigq T C 17: 25,932,209 H322R probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prpf39 C T 12: 65,044,012 R32* probably null Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Pth2r G T 1: 65,336,769 W62L probably damaging Het
Scin T A 12: 40,068,931 K622I probably damaging Het
Serpinb6a T C 13: 33,925,320 K143R probably damaging Het
Ska1 G T 18: 74,197,066 probably null Het
Slc30a8 G T 15: 52,306,564 R62S probably benign Het
Slc8a3 A C 12: 81,315,220 I275S probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
St5 T C 7: 109,557,207 D112G probably benign Het
Sult1c2 G T 17: 53,831,820 T243K probably benign Het
Svil T A 18: 5,046,640 M1K probably null Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Thegl A G 5: 77,059,405 I337V possibly damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc3 T C 16: 94,459,972 S1439P probably benign Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp20 A G 2: 31,018,738 N777S probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in Kansl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Kansl2 APN 15 98528853 splice site probably benign
IGL02167:Kansl2 APN 15 98533515 splice site probably benign
IGL02349:Kansl2 APN 15 98529446 missense probably damaging 1.00
R0004:Kansl2 UTSW 15 98520376 missense probably damaging 1.00
R1128:Kansl2 UTSW 15 98533685 nonsense probably null
R1129:Kansl2 UTSW 15 98533581 missense probably damaging 1.00
R1311:Kansl2 UTSW 15 98528916 missense possibly damaging 0.93
R2132:Kansl2 UTSW 15 98529397 missense probably damaging 1.00
R2144:Kansl2 UTSW 15 98526631 missense probably benign 0.00
R2510:Kansl2 UTSW 15 98528861 critical splice donor site probably null
R3433:Kansl2 UTSW 15 98528861 critical splice donor site probably null
R4125:Kansl2 UTSW 15 98531755 missense possibly damaging 0.79
R4818:Kansl2 UTSW 15 98526661 missense possibly damaging 0.48
R4906:Kansl2 UTSW 15 98531890 missense possibly damaging 0.83
R4962:Kansl2 UTSW 15 98531843 missense probably benign 0.01
R5973:Kansl2 UTSW 15 98529425 missense probably damaging 1.00
R6014:Kansl2 UTSW 15 98520316 critical splice donor site probably null
R6077:Kansl2 UTSW 15 98531431 missense probably benign 0.08
R6657:Kansl2 UTSW 15 98524670 missense possibly damaging 0.67
R7168:Kansl2 UTSW 15 98529544 splice site probably null
R7418:Kansl2 UTSW 15 98531894 missense possibly damaging 0.95
R7530:Kansl2 UTSW 15 98529015 missense probably benign 0.01
R7957:Kansl2 UTSW 15 98524618 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGCTCTACGAATCCCATCC -3'
(R):5'- ATGCTGCCAGGGATCTGAAG -3'

Sequencing Primer
(F):5'- TGGATCACGAGTTCACGTTCAAC -3'
(R):5'- GATCTGAAGAGGTCCCCTGCAAC -3'
Posted On2014-10-15