Incidental Mutation 'R2232:BC027072'
ID240141
Institutional Source Beutler Lab
Gene Symbol BC027072
Ensembl Gene ENSMUSG00000044375
Gene NamecDNA sequence BC027072
Synonyms
MMRRC Submission 040233-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R2232 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71743557-71752885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71749284 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1133 (S1133P)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
Predicted Effect probably benign
Transcript: ENSMUST00000057405
AA Change: S1133P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: S1133P

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T A 8: 36,512,553 C437S probably damaging Het
Adam1a A C 5: 121,519,732 D499E possibly damaging Het
Adamtsl2 G A 2: 27,103,178 G740E probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Akap9 G A 5: 4,046,603 V2493I probably damaging Het
Ankra2 T C 13: 98,271,138 F199L probably damaging Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Asns A G 6: 7,689,316 I62T possibly damaging Het
Celf3 T A 3: 94,480,259 probably null Het
Cyp4f37 A G 17: 32,634,270 T403A probably benign Het
Dgkd T A 1: 87,929,742 S725R probably benign Het
Dnah5 G A 15: 28,408,417 probably null Het
Ergic3 A G 2: 156,017,816 T346A probably damaging Het
Fam189a1 G A 7: 64,759,222 H475Y probably damaging Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Ghrhr T C 6: 55,385,459 F347S probably damaging Het
Htr2a A T 14: 74,645,029 I152F probably damaging Het
Il17re T C 6: 113,464,800 C219R probably damaging Het
Kansl2 A G 15: 98,524,478 L403S probably damaging Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Lrrk2 A G 15: 91,764,716 K1638E probably benign Het
Mcpt9 A T 14: 56,027,988 C85S probably benign Het
Mindy3 C A 2: 12,404,045 R73M probably benign Het
Mrgprb3 T C 7: 48,643,022 I260M probably benign Het
Nes T A 3: 87,978,931 I1499N possibly damaging Het
Ninl A G 2: 150,950,050 V851A probably benign Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Olfr1406 A G 1: 173,183,615 I273T probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Pigq T C 17: 25,932,209 H322R probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Proz A G 8: 13,063,356 Y59C probably damaging Het
Prpf39 C T 12: 65,044,012 R32* probably null Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Pth2r G T 1: 65,336,769 W62L probably damaging Het
Scin T A 12: 40,068,931 K622I probably damaging Het
Serpinb6a T C 13: 33,925,320 K143R probably damaging Het
Ska1 G T 18: 74,197,066 probably null Het
Slc30a8 G T 15: 52,306,564 R62S probably benign Het
Slc8a3 A C 12: 81,315,220 I275S probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Sspo A G 6: 48,448,672 I76V probably damaging Het
St5 T C 7: 109,557,207 D112G probably benign Het
Sult1c2 G T 17: 53,831,820 T243K probably benign Het
Svil T A 18: 5,046,640 M1K probably null Het
Tet3 T C 6: 83,369,471 D1328G probably damaging Het
Thegl A G 5: 77,059,405 I337V possibly damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc3 T C 16: 94,459,972 S1439P probably benign Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp20 A G 2: 31,018,738 N777S probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Other mutations in BC027072
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:BC027072 APN 17 71749464 missense probably benign 0.38
IGL02033:BC027072 APN 17 71751081 missense probably damaging 1.00
IGL02711:BC027072 APN 17 71749382 missense probably benign 0.15
IGL03185:BC027072 APN 17 71749337 missense probably damaging 0.98
IGL03242:BC027072 APN 17 71750271 missense probably benign 0.01
R0367:BC027072 UTSW 17 71750476 missense probably damaging 1.00
R0413:BC027072 UTSW 17 71752217 missense probably benign 0.38
R0465:BC027072 UTSW 17 71750160 missense probably benign 0.42
R0535:BC027072 UTSW 17 71752439 missense probably benign 0.01
R0681:BC027072 UTSW 17 71749514 missense probably benign 0.00
R0736:BC027072 UTSW 17 71744664 missense probably benign 0.00
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1530:BC027072 UTSW 17 71749478 missense probably benign 0.01
R1723:BC027072 UTSW 17 71750378 missense probably damaging 1.00
R1941:BC027072 UTSW 17 71752068 missense probably damaging 1.00
R2179:BC027072 UTSW 17 71752526 missense probably damaging 1.00
R2519:BC027072 UTSW 17 71751647 missense probably damaging 1.00
R2997:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
R3899:BC027072 UTSW 17 71750160 missense probably benign 0.00
R4890:BC027072 UTSW 17 71752311 missense possibly damaging 0.50
R4898:BC027072 UTSW 17 71751071 missense probably damaging 1.00
R5347:BC027072 UTSW 17 71749935 missense probably benign 0.00
R5436:BC027072 UTSW 17 71750842 missense probably damaging 1.00
R5527:BC027072 UTSW 17 71752640 missense probably damaging 1.00
R5556:BC027072 UTSW 17 71752425 missense possibly damaging 0.81
R5625:BC027072 UTSW 17 71751326 missense probably damaging 1.00
R5707:BC027072 UTSW 17 71751572 missense possibly damaging 0.90
R5932:BC027072 UTSW 17 71751753 missense probably damaging 1.00
R6043:BC027072 UTSW 17 71750042 missense probably damaging 1.00
R6314:BC027072 UTSW 17 71752457 missense probably benign 0.04
R6513:BC027072 UTSW 17 71744706 missense probably damaging 1.00
R7575:BC027072 UTSW 17 71750855 missense probably damaging 1.00
R7638:BC027072 UTSW 17 71750885 missense probably damaging 1.00
R7848:BC027072 UTSW 17 71749193 missense probably benign 0.04
R8317:BC027072 UTSW 17 71749202 missense probably benign 0.10
X0035:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
Z1177:BC027072 UTSW 17 71750403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAATTCCCAGTCTGAGCG -3'
(R):5'- AAAGAGCACAGTGGGCATCC -3'

Sequencing Primer
(F):5'- TCTGAGCGGGACTGCTGAAG -3'
(R):5'- GTCATGGACCATCCCAGC -3'
Posted On2014-10-15