Mutagenetix > Incidental Mutations

Incidental Mutation 'R2233:Adam23'

240149

Institutional Source

Beutler Lab

Gene Symbol

Adam23

Ensembl Gene

ENSMUSG00000025964

Gene Name

a disintegrin and metallopeptidase domain 23

Synonyms

MDC3

MMRRC Submission

040234-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2233 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63445891-63596276 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63545512 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 360 (I360V)

Ref Sequence

ENSEMBL: ENSMUSP00000109742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]

Predicted Effect

probably benign
Transcript: ENSMUST00000087374
AA Change: I360V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: I360V

Domain	Start	End	E-Value	Type
signal peptide	1	55	N/A	INTRINSIC
Pfam:Pep_M12B_propep	89	247	1.8e-30	PFAM
Pfam:Reprolysin_5	295	470	4.3e-9	PFAM
Pfam:Reprolysin	296	493	1.1e-58	PFAM
Pfam:Reprolysin_3	320	426	1.4e-8	PFAM
DISIN	508	583	2.81e-28	SMART
ACR	584	725	1.11e-60	SMART
EGF	732	766	1.87e1	SMART
transmembrane domain	791	813	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000097717

SMART Domains

Protein: ENSMUSP00000095324
Gene: ENSMUSG00000025964

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	2	63	6.3e-16	PFAM
Pfam:Reprolysin_5	111	286	2.7e-7	PFAM
Pfam:Reprolysin	112	309	5.7e-57	PFAM
Pfam:Reprolysin_3	136	240	8.7e-7	PFAM
DISIN	324	399	1.4e-30	SMART
ACR	400	541	3.6e-63	SMART
EGF	548	582	9e-2	SMART
transmembrane domain	607	629	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114101

SMART Domains

Protein: ENSMUSP00000109736
Gene: ENSMUSG00000025964

Domain	Start	End	E-Value	Type
signal peptide	1	55	N/A	INTRINSIC
Pfam:Pep_M12B_propep	87	247	1.3e-30	PFAM
Pfam:Reprolysin_5	295	470	3.3e-9	PFAM
Pfam:Reprolysin	296	493	8.1e-59	PFAM
Pfam:Reprolysin_3	320	426	1.1e-8	PFAM
DISIN	508	583	2.81e-28	SMART
ACR	584	686	4.34e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114103
AA Change: I360V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964
AA Change: I360V

Domain	Start	End	E-Value	Type
signal peptide	1	55	N/A	INTRINSIC
Pfam:Pep_M12B_propep	89	247	1.8e-30	PFAM
Pfam:Reprolysin_5	295	470	4.3e-9	PFAM
Pfam:Reprolysin	296	493	1.1e-58	PFAM
Pfam:Reprolysin_3	320	426	1.4e-8	PFAM
DISIN	508	583	2.81e-28	SMART
ACR	584	725	1.11e-60	SMART
EGF	732	766	1.87e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114107
AA Change: I360V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964
AA Change: I360V

Domain	Start	End	E-Value	Type
signal peptide	1	55	N/A	INTRINSIC
Pfam:Pep_M12B_propep	89	247	1.8e-30	PFAM
Pfam:Reprolysin_5	295	470	4.3e-9	PFAM
Pfam:Reprolysin	296	493	1.1e-58	PFAM
Pfam:Reprolysin_3	320	426	1.4e-8	PFAM
DISIN	508	583	2.81e-28	SMART
ACR	584	725	1.11e-60	SMART
EGF	732	766	1.87e1	SMART
transmembrane domain	791	813	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182642

SMART Domains

Protein: ENSMUSP00000138362
Gene: ENSMUSG00000025964

Domain	Start	End	E-Value	Type
signal peptide	1	55	N/A	INTRINSIC
Pfam:Pep_M12B_propep	89	247	2.2e-30	PFAM
Pfam:Reprolysin_5	295	470	4.6e-9	PFAM
Pfam:Reprolysin	296	493	1.4e-58	PFAM
Pfam:Reprolysin_3	320	426	1.6e-8	PFAM
DISIN	508	583	2.81e-28	SMART
ACR	584	725	1.11e-60	SMART
EGF	732	766	1.87e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190658

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adarb1	A	G	10: 77,317,349	V322A	probably damaging	Het
Atad2b	T	G	12: 5,006,745	F867C	probably damaging	Het
Ccdc24	T	C	4: 117,869,916	K79R	possibly damaging	Het
Cfap44	A	G	16: 44,451,525	I1214V	probably benign	Het
Chrm4	A	G	2: 91,928,530	S428G	probably benign	Het
Chrnb1	A	T	11: 69,795,602	I64N	probably damaging	Het
Crh	A	T	3: 19,693,932	M182K	probably damaging	Het
Dazap1	A	G	10: 80,277,599	K110E	possibly damaging	Het
Dhx16	T	C	17: 35,887,886	C737R	probably damaging	Het
Dst	A	G	1: 34,274,262	E6384G	probably damaging	Het
Dync1i2	C	T	2: 71,249,420	Q419*	probably null	Het
E2f4	T	A	8: 105,298,651	V121E	probably damaging	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	C	6: 23,246,003	T388A	probably damaging	Het
Gimap6	T	A	6: 48,704,484	H72L	possibly damaging	Het
Gm11149	A	G	9: 49,562,146		probably benign	Het
Gm12695	C	T	4: 96,724,029	R499Q	probably damaging	Het
Grhl1	A	G	12: 24,608,511	D385G	probably damaging	Het
Hyou1	C	T	9: 44,389,091	T855M	probably benign	Het
Igf1r	T	A	7: 68,212,080	N1129K	probably damaging	Het
Iglon5	T	C	7: 43,480,638	E34G	probably damaging	Het
Kcnab1	T	A	3: 65,319,467	V189D	probably damaging	Het
Kifap3	T	A	1: 163,856,065	D438E	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrrc41	G	A	4: 116,096,385	R756Q	possibly damaging	Het
Lrrc49	A	T	9: 60,598,157	F538L	possibly damaging	Het
Nphp3	G	A	9: 104,037,376	R1052H	probably benign	Het
Nynrin	G	A	14: 55,872,067	V1544I	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1154	G	A	2: 87,903,475	S67F	probably damaging	Het
Olfr1346	T	C	7: 6,474,442	S111P	possibly damaging	Het
Osbpl6	T	C	2: 76,586,769	F577L	probably damaging	Het
Otc	A	G	X: 10,303,367	Q216R	probably benign	Het
Ppp1r12a	A	G	10: 108,198,919	I108M	possibly damaging	Het
Prl7a1	C	A	13: 27,642,419		probably null	Het
Prss16	T	C	13: 22,009,409	D72G	possibly damaging	Het
Qrsl1	T	C	10: 43,896,096	K33E	probably benign	Het
Rabepk	A	T	2: 34,795,234	I58N	possibly damaging	Het
Ralgapa1	A	T	12: 55,717,071	H1403Q	probably benign	Het
Rhobtb3	C	A	13: 75,872,365	C606F	possibly damaging	Het
Rnf216	G	A	5: 143,090,926	H68Y	probably benign	Het
Scap	T	C	9: 110,381,593	C998R	probably damaging	Het
Scgb1b27	T	C	7: 34,021,824	Y46H	probably damaging	Het
Sel1l2	T	C	2: 140,244,165	Y502C	probably damaging	Het
Sf3a2	G	T	10: 80,802,829	A95S	probably benign	Het
Sis	A	T	3: 72,913,194	F1412L	probably benign	Het
Slc25a29	A	T	12: 108,835,661	C9S	possibly damaging	Het
Snap91	T	C	9: 86,798,571	T427A	probably benign	Het
St3gal6	A	G	16: 58,473,534	F211L	probably damaging	Het
Stab1	G	A	14: 31,161,880	S240F	probably benign	Het
Sun3	T	A	11: 9,023,371	K109*	probably null	Het
Syne1	T	C	10: 5,041,484	N8410S	probably benign	Het
Tbx18	G	T	9: 87,724,350	S247R	probably damaging	Het
Tenm3	T	C	8: 48,276,169	I1601V	probably benign	Het
Tmem135	T	C	7: 89,154,074	N297S	probably damaging	Het
Tnk1	C	T	11: 69,855,191		probably null	Het
Txnl4b	A	G	8: 109,568,919		probably benign	Het
Uck1	T	C	2: 32,258,303	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,049,665	H61L	possibly damaging	Het
Xylt2	C	T	11: 94,669,996	V239M	possibly damaging	Het
Zmpste24	T	C	4: 121,097,965	D12G	probably benign	Het
Zscan25	A	G	5: 145,283,692	Y99C	probably damaging	Het

Other mutations in Adam23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Adam23	APN	1	63570954	missense	probably damaging	0.99
IGL00957:Adam23	APN	1	63534311	missense	probably benign	0.27
IGL01338:Adam23	APN	1	63551855	missense	possibly damaging	0.50
IGL01835:Adam23	APN	1	63543119	missense	probably damaging	1.00
IGL01928:Adam23	APN	1	63557446	missense	probably damaging	1.00
IGL02563:Adam23	APN	1	63567977	splice site	probably benign
IGL02981:Adam23	APN	1	63570953	missense	probably damaging	0.99
IGL03037:Adam23	APN	1	63571017	missense	possibly damaging	0.63
IGL03176:Adam23	APN	1	63563416	missense	probably damaging	1.00
BB007:Adam23	UTSW	1	63585427	missense	possibly damaging	0.89
BB017:Adam23	UTSW	1	63585427	missense	possibly damaging	0.89
IGL02991:Adam23	UTSW	1	63547819	critical splice donor site	probably null
R0057:Adam23	UTSW	1	63570919	missense	probably damaging	1.00
R0057:Adam23	UTSW	1	63570919	missense	probably damaging	1.00
R0125:Adam23	UTSW	1	63534356	missense	probably benign	0.00
R0477:Adam23	UTSW	1	63557400	splice site	probably benign
R0538:Adam23	UTSW	1	63567844	splice site	probably benign
R0617:Adam23	UTSW	1	63543147	missense	probably benign	0.06
R1506:Adam23	UTSW	1	63547814	missense	probably benign	0.01
R1599:Adam23	UTSW	1	63570933	missense	possibly damaging	0.65
R1755:Adam23	UTSW	1	63543170	missense	probably damaging	1.00
R1813:Adam23	UTSW	1	63545572	missense	probably benign	0.07
R1858:Adam23	UTSW	1	63557456	missense	probably benign	0.12
R1896:Adam23	UTSW	1	63545572	missense	probably benign	0.07
R1943:Adam23	UTSW	1	63477757	critical splice donor site	probably null
R2147:Adam23	UTSW	1	63534362	splice site	probably null
R2211:Adam23	UTSW	1	63573129	intron	probably benign
R2249:Adam23	UTSW	1	63535176	nonsense	probably null
R2363:Adam23	UTSW	1	63557491	splice site	probably null
R3800:Adam23	UTSW	1	63551774	nonsense	probably null
R3974:Adam23	UTSW	1	63547729	nonsense	probably null
R3975:Adam23	UTSW	1	63547729	nonsense	probably null
R4066:Adam23	UTSW	1	63563425	missense	probably damaging	1.00
R4382:Adam23	UTSW	1	63566628	missense	probably damaging	1.00
R4383:Adam23	UTSW	1	63566628	missense	probably damaging	1.00
R4384:Adam23	UTSW	1	63566628	missense	probably damaging	1.00
R4385:Adam23	UTSW	1	63566628	missense	probably damaging	1.00
R5385:Adam23	UTSW	1	63551811	missense	possibly damaging	0.74
R5435:Adam23	UTSW	1	63546453	missense	possibly damaging	0.73
R6465:Adam23	UTSW	1	63566668	missense	probably damaging	1.00
R6490:Adam23	UTSW	1	63557454	missense	probably damaging	1.00
R6967:Adam23	UTSW	1	63563336	splice site	probably null
R7139:Adam23	UTSW	1	63545577	missense	probably damaging	1.00
R7584:Adam23	UTSW	1	63545462	missense	probably damaging	1.00
R7930:Adam23	UTSW	1	63585427	missense	possibly damaging	0.89
R8261:Adam23	UTSW	1	63528798	missense	noncoding transcript
R8425:Adam23	UTSW	1	63585377	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTAATTCTGACCCCATGTTC -3'
(R):5'- TGAAGGCCACTGAACCAAGC -3'

Sequencing Primer
(F):5'- AATTCTGACCCCATGTTCTCTCC -3'
(R):5'- TTCTACTTCCATAAACCCAGAAGG -3'

Posted On

2014-10-15