Incidental Mutation 'R2233:Uck1'
ID 240152
Institutional Source Beutler Lab
Gene Symbol Uck1
Ensembl Gene ENSMUSG00000002550
Gene Name uridine-cytidine kinase 1
Synonyms URK1
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2233 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 32255002-32260159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32258303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000002625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002625] [ENSMUST00000036473]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002625
AA Change: D167G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550
AA Change: D167G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:CoaE 30 198 1.1e-8 PFAM
Pfam:AAA_17 31 188 3.8e-8 PFAM
Pfam:PRK 31 225 1.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036473
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134351
Predicted Effect unknown
Transcript: ENSMUST00000138133
AA Change: D93G
SMART Domains Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550
AA Change: D93G

DomainStartEndE-ValueType
Pfam:PRK 1 151 1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142797
Predicted Effect probably benign
Transcript: ENSMUST00000192998
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Uck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Uck1 APN 2 32259669 missense probably damaging 1.00
IGL01765:Uck1 APN 2 32258676 unclassified probably benign
IGL02028:Uck1 APN 2 32258137 missense probably damaging 1.00
IGL02863:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03114:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03159:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03325:Uck1 APN 2 32258322 missense probably benign 0.04
PIT4378001:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R1019:Uck1 UTSW 2 32256193 missense possibly damaging 0.88
R1332:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1336:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1428:Uck1 UTSW 2 32258355 missense probably damaging 1.00
R2173:Uck1 UTSW 2 32256076 unclassified probably benign
R2234:Uck1 UTSW 2 32258303 missense probably damaging 1.00
R2938:Uck1 UTSW 2 32256076 unclassified probably benign
R3079:Uck1 UTSW 2 32258077 unclassified probably benign
R4667:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R5036:Uck1 UTSW 2 32258466 unclassified probably benign
R6463:Uck1 UTSW 2 32258655 missense probably benign 0.00
R7072:Uck1 UTSW 2 32258166 missense probably damaging 1.00
R7690:Uck1 UTSW 2 32258172 missense probably benign 0.03
R8021:Uck1 UTSW 2 32259917 missense probably benign 0.17
R8415:Uck1 UTSW 2 32260141 unclassified probably benign
R8416:Uck1 UTSW 2 32260141 unclassified probably benign
R8437:Uck1 UTSW 2 32260141 unclassified probably benign
R8438:Uck1 UTSW 2 32260141 unclassified probably benign
R8440:Uck1 UTSW 2 32260141 unclassified probably benign
R8442:Uck1 UTSW 2 32260141 unclassified probably benign
R8530:Uck1 UTSW 2 32260141 unclassified probably benign
R8537:Uck1 UTSW 2 32260141 unclassified probably benign
R8749:Uck1 UTSW 2 32256512 missense
Predicted Primers PCR Primer
(F):5'- TTCACAAAGGCGGTGTACTG -3'
(R):5'- ATCGCAGTCTGTTTCCATGG -3'

Sequencing Primer
(F):5'- GTACTGAGTCAGGATCTGCTCC -3'
(R):5'- CAGGCCCCTTGTTACTAATGTGAG -3'
Posted On 2014-10-15