Incidental Mutation 'R2233:Dync1i2'
ID 240154
Institutional Source Beutler Lab
Gene Symbol Dync1i2
Ensembl Gene ENSMUSG00000027012
Gene Name dynein cytoplasmic 1 intermediate chain 2
Synonyms 3110079H08Rik, Dncic2
MMRRC Submission 040234-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R2233 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 71042050-71093647 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 71079764 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 419 (Q419*)
Ref Sequence ENSEMBL: ENSMUSP00000107772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081710] [ENSMUST00000100028] [ENSMUST00000112136] [ENSMUST00000112138] [ENSMUST00000112139] [ENSMUST00000112140] [ENSMUST00000112142] [ENSMUST00000112144]
AlphaFold O88487
Predicted Effect probably null
Transcript: ENSMUST00000081710
AA Change: Q393*
SMART Domains Protein: ENSMUSP00000080410
Gene: ENSMUSG00000027012
AA Change: Q393*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100028
AA Change: Q413*
SMART Domains Protein: ENSMUSP00000097605
Gene: ENSMUSG00000027012
AA Change: Q413*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112136
AA Change: Q419*
SMART Domains Protein: ENSMUSP00000107764
Gene: ENSMUSG00000027012
AA Change: Q419*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 5e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 618 632 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112138
AA Change: Q393*
SMART Domains Protein: ENSMUSP00000107766
Gene: ENSMUSG00000027012
AA Change: Q393*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112139
AA Change: Q393*
SMART Domains Protein: ENSMUSP00000107767
Gene: ENSMUSG00000027012
AA Change: Q393*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 4.5e-21 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 592 606 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112140
AA Change: Q419*
SMART Domains Protein: ENSMUSP00000107768
Gene: ENSMUSG00000027012
AA Change: Q419*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112142
AA Change: Q413*
SMART Domains Protein: ENSMUSP00000107770
Gene: ENSMUSG00000027012
AA Change: Q413*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112144
AA Change: Q419*
SMART Domains Protein: ENSMUSP00000107772
Gene: ENSMUSG00000027012
AA Change: Q419*

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 133 163 6.5e-19 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141619
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit a trend towards slight locomotor deficit. [provided by MGI curators]
Allele List at MGI

All alleles(50) : Targeted, other(2) Gene trapped(48)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,584,671 (GRCm39) I360V probably benign Het
Adarb1 A G 10: 77,153,183 (GRCm39) V322A probably damaging Het
Atad2b T G 12: 5,056,745 (GRCm39) F867C probably damaging Het
Ccdc24 T C 4: 117,727,113 (GRCm39) K79R possibly damaging Het
Cfap44 A G 16: 44,271,888 (GRCm39) I1214V probably benign Het
Chrm4 A G 2: 91,758,875 (GRCm39) S428G probably benign Het
Chrnb1 A T 11: 69,686,428 (GRCm39) I64N probably damaging Het
Crh A T 3: 19,748,096 (GRCm39) M182K probably damaging Het
Dazap1 A G 10: 80,113,433 (GRCm39) K110E possibly damaging Het
Dhx16 T C 17: 36,198,778 (GRCm39) C737R probably damaging Het
Dst A G 1: 34,313,343 (GRCm39) E6384G probably damaging Het
E2f4 T A 8: 106,025,283 (GRCm39) V121E probably damaging Het
Enah G A 1: 181,749,537 (GRCm39) P415L probably damaging Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Fezf1 T C 6: 23,246,002 (GRCm39) T388A probably damaging Het
Gimap6 T A 6: 48,681,418 (GRCm39) H72L possibly damaging Het
Gm11149 A G 9: 49,473,446 (GRCm39) probably benign Het
Gm12695 C T 4: 96,612,266 (GRCm39) R499Q probably damaging Het
Grhl1 A G 12: 24,658,510 (GRCm39) D385G probably damaging Het
Hyou1 C T 9: 44,300,388 (GRCm39) T855M probably benign Het
Igf1r T A 7: 67,861,828 (GRCm39) N1129K probably damaging Het
Iglon5 T C 7: 43,130,062 (GRCm39) E34G probably damaging Het
Kcnab1 T A 3: 65,226,888 (GRCm39) V189D probably damaging Het
Kifap3 T A 1: 163,683,634 (GRCm39) D438E probably benign Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lrrc41 G A 4: 115,953,582 (GRCm39) R756Q possibly damaging Het
Lrrc49 A T 9: 60,505,440 (GRCm39) F538L possibly damaging Het
Nphp3 G A 9: 103,914,575 (GRCm39) R1052H probably benign Het
Nynrin G A 14: 56,109,524 (GRCm39) V1544I possibly damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or6z5 T C 7: 6,477,441 (GRCm39) S111P possibly damaging Het
Or9m1 G A 2: 87,733,819 (GRCm39) S67F probably damaging Het
Osbpl6 T C 2: 76,417,113 (GRCm39) F577L probably damaging Het
Otc A G X: 10,169,606 (GRCm39) Q216R probably benign Het
Ppp1r12a A G 10: 108,034,780 (GRCm39) I108M possibly damaging Het
Prl7a1 C A 13: 27,826,402 (GRCm39) probably null Het
Prss16 T C 13: 22,193,579 (GRCm39) D72G possibly damaging Het
Qrsl1 T C 10: 43,772,092 (GRCm39) K33E probably benign Het
Rabepk A T 2: 34,685,246 (GRCm39) I58N possibly damaging Het
Ralgapa1 A T 12: 55,763,856 (GRCm39) H1403Q probably benign Het
Rhobtb3 C A 13: 76,020,484 (GRCm39) C606F possibly damaging Het
Rnf216 G A 5: 143,076,681 (GRCm39) H68Y probably benign Het
Scap T C 9: 110,210,661 (GRCm39) C998R probably damaging Het
Scgb1b27 T C 7: 33,721,249 (GRCm39) Y46H probably damaging Het
Sel1l2 T C 2: 140,086,085 (GRCm39) Y502C probably damaging Het
Sf3a2 G T 10: 80,638,663 (GRCm39) A95S probably benign Het
Sis A T 3: 72,820,527 (GRCm39) F1412L probably benign Het
Slc25a29 A T 12: 108,801,587 (GRCm39) C9S possibly damaging Het
Snap91 T C 9: 86,680,624 (GRCm39) T427A probably benign Het
St3gal6 A G 16: 58,293,897 (GRCm39) F211L probably damaging Het
Stab1 G A 14: 30,883,837 (GRCm39) S240F probably benign Het
Sun3 T A 11: 8,973,371 (GRCm39) K109* probably null Het
Syne1 T C 10: 4,991,484 (GRCm39) N8410S probably benign Het
Tbx18 G T 9: 87,606,403 (GRCm39) S247R probably damaging Het
Tenm3 T C 8: 48,729,204 (GRCm39) I1601V probably benign Het
Tmem135 T C 7: 88,803,282 (GRCm39) N297S probably damaging Het
Tnk1 C T 11: 69,746,017 (GRCm39) probably null Het
Txnl4b A G 8: 110,295,551 (GRCm39) probably benign Het
Uck1 T C 2: 32,148,315 (GRCm39) D167G probably damaging Het
Vmn2r124 A T 17: 18,269,927 (GRCm39) H61L possibly damaging Het
Xylt2 C T 11: 94,560,822 (GRCm39) V239M possibly damaging Het
Zmpste24 T C 4: 120,955,162 (GRCm39) D12G probably benign Het
Zscan25 A G 5: 145,220,502 (GRCm39) Y99C probably damaging Het
Other mutations in Dync1i2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Dync1i2 APN 2 71,078,299 (GRCm39) splice site probably benign
IGL01609:Dync1i2 APN 2 71,077,352 (GRCm39) splice site probably benign
IGL02479:Dync1i2 APN 2 71,066,323 (GRCm39) missense probably damaging 1.00
IGL02545:Dync1i2 APN 2 71,093,095 (GRCm39) missense possibly damaging 0.95
3-1:Dync1i2 UTSW 2 71,078,172 (GRCm39) missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71,044,828 (GRCm39) missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71,044,828 (GRCm39) missense probably damaging 1.00
R0437:Dync1i2 UTSW 2 71,058,169 (GRCm39) critical splice acceptor site probably null
R0555:Dync1i2 UTSW 2 71,044,862 (GRCm39) frame shift probably null
R0835:Dync1i2 UTSW 2 71,081,316 (GRCm39) missense probably damaging 1.00
R1146:Dync1i2 UTSW 2 71,058,164 (GRCm39) splice site probably benign
R1452:Dync1i2 UTSW 2 71,080,207 (GRCm39) splice site probably benign
R1662:Dync1i2 UTSW 2 71,081,323 (GRCm39) missense possibly damaging 0.87
R1765:Dync1i2 UTSW 2 71,079,759 (GRCm39) missense probably benign
R2059:Dync1i2 UTSW 2 71,080,197 (GRCm39) critical splice donor site probably null
R2145:Dync1i2 UTSW 2 71,044,907 (GRCm39) splice site probably benign
R2234:Dync1i2 UTSW 2 71,079,764 (GRCm39) nonsense probably null
R2235:Dync1i2 UTSW 2 71,079,764 (GRCm39) nonsense probably null
R3151:Dync1i2 UTSW 2 71,064,060 (GRCm39) splice site probably benign
R3916:Dync1i2 UTSW 2 71,079,716 (GRCm39) missense probably damaging 1.00
R4653:Dync1i2 UTSW 2 71,078,199 (GRCm39) missense probably damaging 1.00
R4720:Dync1i2 UTSW 2 71,064,018 (GRCm39) missense probably damaging 1.00
R4920:Dync1i2 UTSW 2 71,077,668 (GRCm39) missense probably damaging 1.00
R5574:Dync1i2 UTSW 2 71,063,994 (GRCm39) missense probably benign 0.15
R5620:Dync1i2 UTSW 2 71,088,483 (GRCm39) missense probably benign 0.00
R5677:Dync1i2 UTSW 2 71,058,967 (GRCm39) missense probably benign 0.00
R5711:Dync1i2 UTSW 2 71,081,326 (GRCm39) missense probably benign 0.31
R6730:Dync1i2 UTSW 2 71,077,484 (GRCm39) missense probably benign 0.18
R6911:Dync1i2 UTSW 2 71,077,446 (GRCm39) missense probably benign
R7140:Dync1i2 UTSW 2 71,078,283 (GRCm39) missense probably benign 0.03
R7257:Dync1i2 UTSW 2 71,079,700 (GRCm39) missense possibly damaging 0.92
R7460:Dync1i2 UTSW 2 71,081,230 (GRCm39) missense probably damaging 0.97
R7808:Dync1i2 UTSW 2 71,081,178 (GRCm39) splice site probably null
R8187:Dync1i2 UTSW 2 71,044,865 (GRCm39) missense probably benign 0.13
R9340:Dync1i2 UTSW 2 71,093,019 (GRCm39) missense probably damaging 0.99
Z1176:Dync1i2 UTSW 2 71,078,228 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCTGGCAGGTTAACAAACC -3'
(R):5'- GAACCAACTCCATGCTATCCTAGAG -3'

Sequencing Primer
(F):5'- GGAATTGGAATACCCGTAATTAGAC -3'
(R):5'- TACCTACCTCAGTTAAATGAAAAAGC -3'
Posted On 2014-10-15