Incidental Mutation 'R2233:Olfr1154'
ID240156
Institutional Source Beutler Lab
Gene Symbol Olfr1154
Ensembl Gene ENSMUSG00000075146
Gene Nameolfactory receptor 1154
SynonymsGA_x6K02T2Q125-49403456-49402524, MOR173-2
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2233 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87901256-87905166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87903475 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 67 (S67F)
Ref Sequence ENSEMBL: ENSMUSP00000148909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099844] [ENSMUST00000215017] [ENSMUST00000215862]
Predicted Effect probably damaging
Transcript: ENSMUST00000099844
AA Change: S67F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097432
Gene: ENSMUSG00000075146
AA Change: S67F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.1e-47 PFAM
Pfam:7tm_1 41 289 3.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215017
AA Change: S67F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215862
AA Change: S67F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Olfr1154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Olfr1154 APN 2 87903527 missense probably benign 0.00
IGL01878:Olfr1154 APN 2 87903331 nonsense probably null
IGL02683:Olfr1154 APN 2 87903104 missense possibly damaging 0.80
IGL02836:Olfr1154 APN 2 87903380 missense possibly damaging 0.81
R0432:Olfr1154 UTSW 2 87902960 missense probably damaging 1.00
R1123:Olfr1154 UTSW 2 87902904 missense probably damaging 0.99
R1223:Olfr1154 UTSW 2 87902819 missense probably damaging 0.99
R1561:Olfr1154 UTSW 2 87903161 missense probably benign 0.00
R1964:Olfr1154 UTSW 2 87903667 missense probably benign 0.00
R2041:Olfr1154 UTSW 2 87902797 missense probably damaging 1.00
R2219:Olfr1154 UTSW 2 87902925 nonsense probably null
R3719:Olfr1154 UTSW 2 87903103 missense probably benign 0.05
R4826:Olfr1154 UTSW 2 87903349 missense probably damaging 1.00
R4908:Olfr1154 UTSW 2 87903189 missense probably damaging 1.00
R5056:Olfr1154 UTSW 2 87903571 missense probably damaging 1.00
R5589:Olfr1154 UTSW 2 87903347 missense probably benign 0.26
R6477:Olfr1154 UTSW 2 87902990 missense probably damaging 1.00
R6532:Olfr1154 UTSW 2 87903202 missense probably damaging 1.00
R6666:Olfr1154 UTSW 2 87903508 missense probably damaging 1.00
R6693:Olfr1154 UTSW 2 87903308 missense probably damaging 1.00
R6724:Olfr1154 UTSW 2 87903602 missense probably benign 0.00
R7784:Olfr1154 UTSW 2 87903193 missense probably benign 0.01
Z1088:Olfr1154 UTSW 2 87903584 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCTCCAAATGCCAGGTGAG -3'
(R):5'- AAGACTGAATTCTATCTCCTGGG -3'

Sequencing Primer
(F):5'- CTCCAAATGCCAGGTGAGTACAG -3'
(R):5'- GGATTTAGTGATCATCCAGAGCTCC -3'
Posted On2014-10-15