Incidental Mutation 'R2233:Crh'
ID 240161
Institutional Source Beutler Lab
Gene Symbol Crh
Ensembl Gene ENSMUSG00000049796
Gene Name corticotropin releasing hormone
Synonyms corticotropin releasing factor, corticotropin-releasing factor, CRF, LOC383938
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock # R2233 (G1)
Quality Score 134
Status Not validated
Chromosome 3
Chromosomal Location 19693401-19695396 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19693932 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 182 (M182K)
Ref Sequence ENSEMBL: ENSMUSP00000061185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029139] [ENSMUST00000061294]
AlphaFold Q8CIT0
Predicted Effect probably benign
Transcript: ENSMUST00000029139
SMART Domains Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913

DomainStartEndE-ValueType
RING 26 81 3.69e-8 SMART
BBOX 119 161 3.58e-6 SMART
Blast:BBC 168 294 2e-33 BLAST
PDB:4M3L|D 215 272 2e-12 PDB
low complexity region 329 355 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 514 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061294
AA Change: M182K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061185
Gene: ENSMUSG00000049796
AA Change: M182K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
CRF 146 185 1.55e-16 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the corticotropin-releasing factor family and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a neuropeptide hormone that binds to the corticotropin releasing hormone receptors (CRHR1 and CRHR2) to stimulate the release of adrenocorticotropic hormone from the pituitary gland in response to stress. The encoded protein may also regulate angiogenesis and inflammation. Homozygous knockout mice for this gene exhibit reduced corticosterone levels while the offspring of these mice die perinatally. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have abnormal adrenal gland morphology, decreased corticosterone levels and abnormal corticosteroid responses to stress. Homozygous litters born from homozygous females display neonatal lethality, impaired lung maturation and delayedcornified and granular layer development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Crh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02698:Crh APN 3 19694190 missense possibly damaging 0.80
R0047:Crh UTSW 3 19694037 missense probably damaging 1.00
R0697:Crh UTSW 3 19694077 missense probably damaging 0.99
R0835:Crh UTSW 3 19694364 missense probably benign 0.02
R1201:Crh UTSW 3 19693926 missense probably damaging 0.99
R2034:Crh UTSW 3 19694098 missense probably damaging 1.00
R2234:Crh UTSW 3 19693932 missense probably damaging 1.00
R2235:Crh UTSW 3 19693932 missense probably damaging 1.00
R5045:Crh UTSW 3 19693989 nonsense probably null
R5191:Crh UTSW 3 19693929 missense probably damaging 1.00
R5283:Crh UTSW 3 19694007 missense probably damaging 1.00
R6481:Crh UTSW 3 19694337 missense probably benign 0.13
R6790:Crh UTSW 3 19694295 missense probably damaging 1.00
R6865:Crh UTSW 3 19694140 missense possibly damaging 0.56
R7259:Crh UTSW 3 19694254 missense possibly damaging 0.64
R7758:Crh UTSW 3 19694289 missense probably damaging 1.00
R7981:Crh UTSW 3 19694052 missense probably benign 0.18
R8247:Crh UTSW 3 19694127 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGGGTATATAGGCTCTCTCCC -3'
(R):5'- ATCTCAACAGAAGTCCCGCTG -3'

Sequencing Primer
(F):5'- GGGTATATAGGCTCTCTCCCTGTAC -3'
(R):5'- AGGCTGCGGCTAACTTTTTC -3'
Posted On 2014-10-15