Incidental Mutation 'R2233:Ccdc24'
ID 240167
Institutional Source Beutler Lab
Gene Symbol Ccdc24
Ensembl Gene ENSMUSG00000078588
Gene Name coiled-coil domain containing 24
Synonyms LOC381546
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2233 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 117866524-117872557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117869916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 79 (K79R)
Ref Sequence ENSEMBL: ENSMUSP00000126161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030266] [ENSMUST00000030269] [ENSMUST00000063857] [ENSMUST00000084325] [ENSMUST00000106421] [ENSMUST00000106422] [ENSMUST00000131938] [ENSMUST00000149168] [ENSMUST00000163288] [ENSMUST00000164853] [ENSMUST00000166325] [ENSMUST00000167287] [ENSMUST00000167443] [ENSMUST00000171052] [ENSMUST00000169885]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030266
SMART Domains Protein: ENSMUSP00000030266
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 228 4.2e-59 PFAM
Pfam:Glyco_transf_7C 232 310 2.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030269
SMART Domains Protein: ENSMUSP00000030269
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063857
SMART Domains Protein: ENSMUSP00000066102
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106421
SMART Domains Protein: ENSMUSP00000102029
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106422
AA Change: K199R

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588
AA Change: K199R

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130758
Predicted Effect probably benign
Transcript: ENSMUST00000131938
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154439
Predicted Effect probably benign
Transcript: ENSMUST00000163288
SMART Domains Protein: ENSMUSP00000127289
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 46 566 2.1e-212 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164716
Predicted Effect probably benign
Transcript: ENSMUST00000164853
AA Change: K199R

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588
AA Change: K199R

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166325
SMART Domains Protein: ENSMUSP00000131493
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 33 57 N/A INTRINSIC
low complexity region 61 90 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167287
AA Change: K79R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126161
Gene: ENSMUSG00000078588
AA Change: K79R

DomainStartEndE-ValueType
coiled coil region 13 38 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171052
AA Change: K227R

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588
AA Change: K227R

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170733
Predicted Effect probably benign
Transcript: ENSMUST00000169885
SMART Domains Protein: ENSMUSP00000127093
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 1 450 1.2e-182 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Ccdc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Ccdc24 APN 4 117872046 missense probably damaging 1.00
IGL02396:Ccdc24 APN 4 117869629 missense possibly damaging 0.91
IGL03122:Ccdc24 APN 4 117871745 critical splice donor site probably null
fusarium UTSW 4 117871177 nonsense probably null
R1473:Ccdc24 UTSW 4 117869904 splice site probably benign
R1488:Ccdc24 UTSW 4 117870568 missense possibly damaging 0.88
R1986:Ccdc24 UTSW 4 117872016 missense probably damaging 1.00
R4983:Ccdc24 UTSW 4 117872100 missense probably benign 0.06
R5250:Ccdc24 UTSW 4 117869629 missense possibly damaging 0.91
R5677:Ccdc24 UTSW 4 117869880 intron probably benign
R6092:Ccdc24 UTSW 4 117872448 nonsense probably null
R6265:Ccdc24 UTSW 4 117871177 nonsense probably null
R6284:Ccdc24 UTSW 4 117869653 splice site probably null
R6736:Ccdc24 UTSW 4 117870535 missense possibly damaging 0.81
R6814:Ccdc24 UTSW 4 117869926 missense probably benign 0.02
R6872:Ccdc24 UTSW 4 117869926 missense probably benign 0.02
R7016:Ccdc24 UTSW 4 117871116 missense probably null 1.00
R7073:Ccdc24 UTSW 4 117872004 missense probably damaging 1.00
R9151:Ccdc24 UTSW 4 117869905 missense unknown
R9199:Ccdc24 UTSW 4 117871116 missense probably null 1.00
R9345:Ccdc24 UTSW 4 117872494 nonsense probably null
Z1088:Ccdc24 UTSW 4 117871063 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATAGCTGTACCGAAGTTGCC -3'
(R):5'- AATGCCTACCCTGGGAGGTAAG -3'

Sequencing Primer
(F):5'- TGTACCGAAGTTGCCGTCCC -3'
(R):5'- TAAGGTCCCCAGGCGAG -3'
Posted On 2014-10-15