Incidental Mutation 'R2233:Zmpste24'
ID 240168
Institutional Source Beutler Lab
Gene Symbol Zmpste24
Ensembl Gene ENSMUSG00000043207
Gene Name zinc metallopeptidase, STE24
Synonyms A530043O15Rik
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock # R2233 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 121059237-121098241 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121097965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 12 (D12G)
Ref Sequence ENSEMBL: ENSMUSP00000053900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058754] [ENSMUST00000135788]
AlphaFold Q80W54
Predicted Effect probably benign
Transcript: ENSMUST00000058754
AA Change: D12G

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000053900
Gene: ENSMUSG00000043207
AA Change: D12G

DomainStartEndE-ValueType
Pfam:Peptidase_M48_N 41 225 2.5e-70 PFAM
Pfam:Peptidase_M48 228 473 5.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135788
SMART Domains Protein: ENSMUSP00000122588
Gene: ENSMUSG00000043207

DomainStartEndE-ValueType
PDB:2YPT|E 1 146 5e-58 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M48A family. The encoded protein is a zinc metalloproteinase involved in the two step post-translational proteolytic cleavage of carboxy terminal residues of farnesylated prelamin A to form mature lamin A. Mutations in this gene have been associated with mandibuloacral dysplasia and restrictive dermopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are deficient in proteolytic processing of prelamin A and display many abnormalities including retarded growth, bone fragility, hair loss, cardiomyopathy, muscular dystrophy and lipodystrophy. Most die prematurely, but some survive and reproduce. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Zmpste24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Zmpste24 APN 4 121082815 unclassified probably benign
IGL00672:Zmpste24 APN 4 121065860 missense probably damaging 1.00
IGL00828:Zmpste24 APN 4 121074520 missense possibly damaging 0.66
IGL01731:Zmpste24 APN 4 121097884 missense probably benign
IGL01738:Zmpste24 APN 4 121061111 missense probably damaging 1.00
IGL02668:Zmpste24 APN 4 121061100 missense probably damaging 1.00
R0097:Zmpste24 UTSW 4 121095543 splice site probably benign
R0097:Zmpste24 UTSW 4 121095543 splice site probably benign
R0226:Zmpste24 UTSW 4 121081209 missense probably benign 0.00
R0277:Zmpste24 UTSW 4 121082853 missense probably damaging 1.00
R0323:Zmpste24 UTSW 4 121082853 missense probably damaging 1.00
R1822:Zmpste24 UTSW 4 121087316 missense possibly damaging 0.78
R2374:Zmpste24 UTSW 4 121074537 missense probably benign
R3683:Zmpste24 UTSW 4 121061091 missense probably damaging 1.00
R4810:Zmpste24 UTSW 4 121061054 missense probably damaging 1.00
R5169:Zmpste24 UTSW 4 121068717 missense probably damaging 1.00
R5650:Zmpste24 UTSW 4 121082877 missense possibly damaging 0.67
R5709:Zmpste24 UTSW 4 121065878 missense probably benign
R6429:Zmpste24 UTSW 4 121095670 missense probably damaging 0.99
R7165:Zmpste24 UTSW 4 121082894 missense probably null 1.00
R7353:Zmpste24 UTSW 4 121095581 missense probably damaging 1.00
R7498:Zmpste24 UTSW 4 121082831 missense probably benign 0.00
R8416:Zmpste24 UTSW 4 121083359 missense probably benign 0.42
R8958:Zmpste24 UTSW 4 121087311 nonsense probably null
R9138:Zmpste24 UTSW 4 121065821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTTAGGAAGCTCACCGG -3'
(R):5'- GTGACACTTCTGGCAAAGCTG -3'

Sequencing Primer
(F):5'- TTTGCTACATCCGGGCAAAC -3'
(R):5'- CTTCTGGCAAAGCTGAGGGAATG -3'
Posted On 2014-10-15