Incidental Mutation 'R2233:Rnf216'
ID240169
Institutional Source Beutler Lab
Gene Symbol Rnf216
Ensembl Gene ENSMUSG00000045078
Gene Namering finger protein 216
Synonyms2810055G22Rik, Ubce7ip1, F830018F18Rik, UIP83
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2233 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location142990893-143112994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143090926 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 68 (H68Y)
Ref Sequence ENSEMBL: ENSMUSP00000143705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]
Predicted Effect probably benign
Transcript: ENSMUST00000053498
SMART Domains Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197217
Predicted Effect probably benign
Transcript: ENSMUST00000197296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200002
Predicted Effect probably benign
Transcript: ENSMUST00000200430
Predicted Effect probably benign
Transcript: ENSMUST00000200607
AA Change: H68Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: H68Y

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Rnf216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Rnf216 APN 5 143068910 missense possibly damaging 0.67
IGL02502:Rnf216 APN 5 143068867 missense probably damaging 1.00
IGL02536:Rnf216 APN 5 143080240 missense probably benign 0.04
IGL03196:Rnf216 APN 5 143081011 missense probably damaging 1.00
PIT4445001:Rnf216 UTSW 5 143086003 missense probably damaging 1.00
R0270:Rnf216 UTSW 5 143080241 missense possibly damaging 0.63
R0422:Rnf216 UTSW 5 143015654 nonsense probably null
R0422:Rnf216 UTSW 5 143090370 missense probably benign 0.15
R0782:Rnf216 UTSW 5 143068892 missense possibly damaging 0.64
R1109:Rnf216 UTSW 5 143068369 missense probably damaging 1.00
R1917:Rnf216 UTSW 5 142992806 missense probably benign 0.03
R2234:Rnf216 UTSW 5 143090926 missense probably benign
R2235:Rnf216 UTSW 5 143090926 missense probably benign
R2340:Rnf216 UTSW 5 143080334 missense probably damaging 0.99
R3015:Rnf216 UTSW 5 143075725 critical splice donor site probably null
R3726:Rnf216 UTSW 5 143027946 missense probably damaging 0.96
R4231:Rnf216 UTSW 5 143093090 missense probably damaging 1.00
R4885:Rnf216 UTSW 5 143090580 nonsense probably null
R4942:Rnf216 UTSW 5 143093059 missense probably damaging 1.00
R4973:Rnf216 UTSW 5 143090316 missense probably benign
R5291:Rnf216 UTSW 5 143090212 missense probably benign
R5307:Rnf216 UTSW 5 143093002 missense probably damaging 1.00
R5328:Rnf216 UTSW 5 143092999 missense possibly damaging 0.84
R5416:Rnf216 UTSW 5 143015771 nonsense probably null
R5888:Rnf216 UTSW 5 143068314 splice site probably null
R6048:Rnf216 UTSW 5 143068904 missense probably damaging 1.00
R6451:Rnf216 UTSW 5 142992834 missense possibly damaging 0.80
R6595:Rnf216 UTSW 5 143090657 missense probably benign 0.00
R7422:Rnf216 UTSW 5 143090836 missense probably benign 0.01
R7470:Rnf216 UTSW 5 142992725 missense possibly damaging 0.88
R7504:Rnf216 UTSW 5 143075759 missense probably benign 0.27
R7507:Rnf216 UTSW 5 143089802 missense probably damaging 1.00
R7695:Rnf216 UTSW 5 143085904 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCAGAATCATCCTGTGCCCC -3'
(R):5'- ACATGTGGAAATCTTAGGAGGTTG -3'

Sequencing Primer
(F):5'- TCATCCTGTGCCCCAGAAC -3'
(R):5'- GCAGGCATTGATACAGGA -3'
Posted On2014-10-15