Incidental Mutation 'R2233:E2f4'
ID 240180
Institutional Source Beutler Lab
Gene Symbol E2f4
Ensembl Gene ENSMUSG00000014859
Gene Name E2F transcription factor 4
Synonyms
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2233 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 105297663-105305370 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105298651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 121 (V121E)
Ref Sequence ENSEMBL: ENSMUSP00000015003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000057855] [ENSMUST00000212777]
AlphaFold Q8R0K9
Predicted Effect probably damaging
Transcript: ENSMUST00000015003
AA Change: V121E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859
AA Change: V121E

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057855
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212261
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212974
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die postnatally of an increased susceptibility to bacterial infection and exhibit craniofacial defects, erythroid abnormalities, and growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in E2f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:E2f4 APN 8 105304177 unclassified probably benign
IGL01642:E2f4 APN 8 105301336 missense probably damaging 1.00
R0488:E2f4 UTSW 8 105298539 missense probably damaging 0.97
R0534:E2f4 UTSW 8 105304219 missense probably damaging 1.00
R0835:E2f4 UTSW 8 105300508 nonsense probably null
R1548:E2f4 UTSW 8 105304688 makesense probably null
R2120:E2f4 UTSW 8 105300341 missense probably damaging 1.00
R2235:E2f4 UTSW 8 105298651 missense probably damaging 1.00
R7369:E2f4 UTSW 8 105300334 missense probably benign 0.00
R7731:E2f4 UTSW 8 105298633 missense probably damaging 0.99
R8265:E2f4 UTSW 8 105301345 missense probably damaging 1.00
R8293:E2f4 UTSW 8 105297819 missense probably damaging 0.98
R9176:E2f4 UTSW 8 105301368 small deletion probably benign
R9283:E2f4 UTSW 8 105297763 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGGCACCCAGAGATCTTAGG -3'
(R):5'- AAATTTCTGGAACCTGGGGTCC -3'

Sequencing Primer
(F):5'- ATCTTAGGGATCCCACGCTCAG -3'
(R):5'- TGGAAGAGACTGGAGCCTCC -3'
Posted On 2014-10-15