Incidental Mutation 'R2233:E2f4'
ID 240180
Institutional Source Beutler Lab
Gene Symbol E2f4
Ensembl Gene ENSMUSG00000014859
Gene Name E2F transcription factor 4
Synonyms 2010111M04Rik
MMRRC Submission 040234-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2233 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 106024295-106032002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106025283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 121 (V121E)
Ref Sequence ENSEMBL: ENSMUSP00000015003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000057855] [ENSMUST00000212777]
AlphaFold Q8R0K9
Predicted Effect probably damaging
Transcript: ENSMUST00000015003
AA Change: V121E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859
AA Change: V121E

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057855
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212261
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212974
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die postnatally of an increased susceptibility to bacterial infection and exhibit craniofacial defects, erythroid abnormalities, and growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,584,671 (GRCm39) I360V probably benign Het
Adarb1 A G 10: 77,153,183 (GRCm39) V322A probably damaging Het
Atad2b T G 12: 5,056,745 (GRCm39) F867C probably damaging Het
Ccdc24 T C 4: 117,727,113 (GRCm39) K79R possibly damaging Het
Cfap44 A G 16: 44,271,888 (GRCm39) I1214V probably benign Het
Chrm4 A G 2: 91,758,875 (GRCm39) S428G probably benign Het
Chrnb1 A T 11: 69,686,428 (GRCm39) I64N probably damaging Het
Crh A T 3: 19,748,096 (GRCm39) M182K probably damaging Het
Dazap1 A G 10: 80,113,433 (GRCm39) K110E possibly damaging Het
Dhx16 T C 17: 36,198,778 (GRCm39) C737R probably damaging Het
Dst A G 1: 34,313,343 (GRCm39) E6384G probably damaging Het
Dync1i2 C T 2: 71,079,764 (GRCm39) Q419* probably null Het
Enah G A 1: 181,749,537 (GRCm39) P415L probably damaging Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Fezf1 T C 6: 23,246,002 (GRCm39) T388A probably damaging Het
Gimap6 T A 6: 48,681,418 (GRCm39) H72L possibly damaging Het
Gm11149 A G 9: 49,473,446 (GRCm39) probably benign Het
Gm12695 C T 4: 96,612,266 (GRCm39) R499Q probably damaging Het
Grhl1 A G 12: 24,658,510 (GRCm39) D385G probably damaging Het
Hyou1 C T 9: 44,300,388 (GRCm39) T855M probably benign Het
Igf1r T A 7: 67,861,828 (GRCm39) N1129K probably damaging Het
Iglon5 T C 7: 43,130,062 (GRCm39) E34G probably damaging Het
Kcnab1 T A 3: 65,226,888 (GRCm39) V189D probably damaging Het
Kifap3 T A 1: 163,683,634 (GRCm39) D438E probably benign Het
Lmo2 T C 2: 103,811,407 (GRCm39) Y147H probably damaging Het
Lrrc41 G A 4: 115,953,582 (GRCm39) R756Q possibly damaging Het
Lrrc49 A T 9: 60,505,440 (GRCm39) F538L possibly damaging Het
Nphp3 G A 9: 103,914,575 (GRCm39) R1052H probably benign Het
Nynrin G A 14: 56,109,524 (GRCm39) V1544I possibly damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or6z5 T C 7: 6,477,441 (GRCm39) S111P possibly damaging Het
Or9m1 G A 2: 87,733,819 (GRCm39) S67F probably damaging Het
Osbpl6 T C 2: 76,417,113 (GRCm39) F577L probably damaging Het
Otc A G X: 10,169,606 (GRCm39) Q216R probably benign Het
Ppp1r12a A G 10: 108,034,780 (GRCm39) I108M possibly damaging Het
Prl7a1 C A 13: 27,826,402 (GRCm39) probably null Het
Prss16 T C 13: 22,193,579 (GRCm39) D72G possibly damaging Het
Qrsl1 T C 10: 43,772,092 (GRCm39) K33E probably benign Het
Rabepk A T 2: 34,685,246 (GRCm39) I58N possibly damaging Het
Ralgapa1 A T 12: 55,763,856 (GRCm39) H1403Q probably benign Het
Rhobtb3 C A 13: 76,020,484 (GRCm39) C606F possibly damaging Het
Rnf216 G A 5: 143,076,681 (GRCm39) H68Y probably benign Het
Scap T C 9: 110,210,661 (GRCm39) C998R probably damaging Het
Scgb1b27 T C 7: 33,721,249 (GRCm39) Y46H probably damaging Het
Sel1l2 T C 2: 140,086,085 (GRCm39) Y502C probably damaging Het
Sf3a2 G T 10: 80,638,663 (GRCm39) A95S probably benign Het
Sis A T 3: 72,820,527 (GRCm39) F1412L probably benign Het
Slc25a29 A T 12: 108,801,587 (GRCm39) C9S possibly damaging Het
Snap91 T C 9: 86,680,624 (GRCm39) T427A probably benign Het
St3gal6 A G 16: 58,293,897 (GRCm39) F211L probably damaging Het
Stab1 G A 14: 30,883,837 (GRCm39) S240F probably benign Het
Sun3 T A 11: 8,973,371 (GRCm39) K109* probably null Het
Syne1 T C 10: 4,991,484 (GRCm39) N8410S probably benign Het
Tbx18 G T 9: 87,606,403 (GRCm39) S247R probably damaging Het
Tenm3 T C 8: 48,729,204 (GRCm39) I1601V probably benign Het
Tmem135 T C 7: 88,803,282 (GRCm39) N297S probably damaging Het
Tnk1 C T 11: 69,746,017 (GRCm39) probably null Het
Txnl4b A G 8: 110,295,551 (GRCm39) probably benign Het
Uck1 T C 2: 32,148,315 (GRCm39) D167G probably damaging Het
Vmn2r124 A T 17: 18,269,927 (GRCm39) H61L possibly damaging Het
Xylt2 C T 11: 94,560,822 (GRCm39) V239M possibly damaging Het
Zmpste24 T C 4: 120,955,162 (GRCm39) D12G probably benign Het
Zscan25 A G 5: 145,220,502 (GRCm39) Y99C probably damaging Het
Other mutations in E2f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:E2f4 APN 8 106,030,809 (GRCm39) unclassified probably benign
IGL01642:E2f4 APN 8 106,027,968 (GRCm39) missense probably damaging 1.00
R0488:E2f4 UTSW 8 106,025,171 (GRCm39) missense probably damaging 0.97
R0534:E2f4 UTSW 8 106,030,851 (GRCm39) missense probably damaging 1.00
R0835:E2f4 UTSW 8 106,027,140 (GRCm39) nonsense probably null
R1548:E2f4 UTSW 8 106,031,320 (GRCm39) makesense probably null
R2120:E2f4 UTSW 8 106,026,973 (GRCm39) missense probably damaging 1.00
R2235:E2f4 UTSW 8 106,025,283 (GRCm39) missense probably damaging 1.00
R7369:E2f4 UTSW 8 106,026,966 (GRCm39) missense probably benign 0.00
R7731:E2f4 UTSW 8 106,025,265 (GRCm39) missense probably damaging 0.99
R8265:E2f4 UTSW 8 106,027,977 (GRCm39) missense probably damaging 1.00
R8293:E2f4 UTSW 8 106,024,451 (GRCm39) missense probably damaging 0.98
R9283:E2f4 UTSW 8 106,024,395 (GRCm39) missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGGCACCCAGAGATCTTAGG -3'
(R):5'- AAATTTCTGGAACCTGGGGTCC -3'

Sequencing Primer
(F):5'- ATCTTAGGGATCCCACGCTCAG -3'
(R):5'- TGGAAGAGACTGGAGCCTCC -3'
Posted On 2014-10-15