Incidental Mutation 'R2233:Chrnb1'
ID 240198
Institutional Source Beutler Lab
Gene Symbol Chrnb1
Ensembl Gene ENSMUSG00000041189
Gene Name cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)
Synonyms AChR beta, Acrb, Achr-2
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock # R2233 (G1)
Quality Score 164
Status Not validated
Chromosome 11
Chromosomal Location 69784036-69795943 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69795602 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 64 (I64N)
Ref Sequence ENSEMBL: ENSMUSP00000047270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011285] [ENSMUST00000045971] [ENSMUST00000102585]
AlphaFold P09690
Predicted Effect probably benign
Transcript: ENSMUST00000011285
SMART Domains Protein: ENSMUSP00000011285
Gene: ENSMUSG00000042826

DomainStartEndE-ValueType
FGF 69 172 6.95e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000045971
AA Change: I64N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047270
Gene: ENSMUSG00000041189
AA Change: I64N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 27 245 3.6e-65 PFAM
Pfam:Neur_chan_memb 252 487 3.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102585
SMART Domains Protein: ENSMUSP00000099645
Gene: ENSMUSG00000042826

DomainStartEndE-ValueType
FGF 69 200 3.43e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154816
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscle acetylcholine receptor is composed of five subunits: two alpha subunits and one beta, one gamma, and one delta subunit. This gene encodes the beta subunit of the acetylcholine receptor. The acetylcholine receptor changes conformation upon acetylcholine binding leading to the opening of an ion-conducting channel across the plasma membrane. Mutations in this gene are associated with slow-channel congenital myasthenic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele lack all tyrosine residues in the beta subunit intracellular loop, display reduced and simplified neuromuscular junctions, and show defective acetylcholine receptor clustering and anchoring at synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Chrnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Chrnb1 APN 11 69793916 missense probably damaging 1.00
IGL01924:Chrnb1 APN 11 69795019 unclassified probably benign
IGL01983:Chrnb1 APN 11 69795729 missense probably benign 0.27
IGL02100:Chrnb1 APN 11 69793455 unclassified probably benign
IGL02507:Chrnb1 APN 11 69785090 missense probably damaging 1.00
IGL02814:Chrnb1 APN 11 69795680 missense probably damaging 1.00
IGL02858:Chrnb1 APN 11 69785109 missense possibly damaging 0.58
R0368:Chrnb1 UTSW 11 69784757 missense probably damaging 1.00
R1728:Chrnb1 UTSW 11 69785762 missense probably damaging 1.00
R1913:Chrnb1 UTSW 11 69793584 missense possibly damaging 0.95
R1930:Chrnb1 UTSW 11 69792737 missense possibly damaging 0.81
R2234:Chrnb1 UTSW 11 69795602 missense probably damaging 0.98
R3971:Chrnb1 UTSW 11 69792916 unclassified probably benign
R4183:Chrnb1 UTSW 11 69787096 missense possibly damaging 0.50
R4425:Chrnb1 UTSW 11 69786947 missense probably damaging 1.00
R4822:Chrnb1 UTSW 11 69795675 missense possibly damaging 0.55
R4983:Chrnb1 UTSW 11 69793978 missense probably damaging 1.00
R5000:Chrnb1 UTSW 11 69787032 missense probably damaging 0.96
R5378:Chrnb1 UTSW 11 69785181 missense probably benign 0.00
R5396:Chrnb1 UTSW 11 69794153 missense probably damaging 1.00
R5540:Chrnb1 UTSW 11 69795650 missense probably benign 0.30
R5574:Chrnb1 UTSW 11 69793683 unclassified probably benign
R5890:Chrnb1 UTSW 11 69792729 missense possibly damaging 0.94
R5973:Chrnb1 UTSW 11 69795845 unclassified probably benign
R6056:Chrnb1 UTSW 11 69786939 missense probably damaging 1.00
R7466:Chrnb1 UTSW 11 69784650 missense probably damaging 1.00
R7633:Chrnb1 UTSW 11 69792873 missense probably damaging 1.00
R7664:Chrnb1 UTSW 11 69787024 missense possibly damaging 0.80
R8266:Chrnb1 UTSW 11 69784621 makesense probably null
R9124:Chrnb1 UTSW 11 69794231 missense probably benign 0.31
Z1177:Chrnb1 UTSW 11 69794189 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTACCTATCATAGAGGCCTCGC -3'
(R):5'- TCTCCAAGAGGCAGTGATGAG -3'

Sequencing Primer
(F):5'- GCCTCGCCCATGAACTAG -3'
(R):5'- ATGAGCAATGGTCACGGCC -3'
Posted On 2014-10-15