Incidental Mutation 'R0164:Zbtb6'
ID 24020
Institutional Source Beutler Lab
Gene Symbol Zbtb6
Ensembl Gene ENSMUSG00000066798
Gene Name zinc finger and BTB domain containing 6
Synonyms Zfp482, A830092L04Rik
MMRRC Submission 038440-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.202) question?
Stock # R0164 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 37315512-37320931 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 37319600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 109 (Y109*)
Ref Sequence ENSEMBL: ENSMUSP00000108554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053098] [ENSMUST00000067043] [ENSMUST00000112932]
AlphaFold Q8K088
Predicted Effect probably null
Transcript: ENSMUST00000053098
AA Change: Y109*
SMART Domains Protein: ENSMUSP00000056100
Gene: ENSMUSG00000066798
AA Change: Y109*

DomainStartEndE-ValueType
BTB 33 127 2.67e-16 SMART
Blast:BTB 161 196 1e-5 BLAST
ZnF_C2H2 300 322 7.15e-2 SMART
ZnF_C2H2 325 347 1.58e-3 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
ZnF_C2H2 381 404 8.81e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067043
SMART Domains Protein: ENSMUSP00000070071
Gene: ENSMUSG00000050714

DomainStartEndE-ValueType
BTB 33 127 4.38e-12 SMART
low complexity region 169 179 N/A INTRINSIC
ZnF_C2H2 273 295 1.36e-2 SMART
ZnF_C2H2 298 320 1.4e-4 SMART
ZnF_C2H2 326 348 2.99e-4 SMART
ZnF_C2H2 354 377 2.09e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112932
AA Change: Y109*
SMART Domains Protein: ENSMUSP00000108554
Gene: ENSMUSG00000066798
AA Change: Y109*

DomainStartEndE-ValueType
BTB 33 127 2.67e-16 SMART
Blast:BTB 161 196 1e-5 BLAST
ZnF_C2H2 300 322 7.15e-2 SMART
ZnF_C2H2 325 347 1.58e-3 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
ZnF_C2H2 381 404 8.81e-2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,057,789 (GRCm39) probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,630,440 (GRCm39) probably null Het
4930522L14Rik T C 5: 109,884,713 (GRCm39) K382E probably damaging Het
Adck1 A G 12: 88,422,280 (GRCm39) E297G probably damaging Het
Ahrr G A 13: 74,431,143 (GRCm39) probably benign Het
Aldh3a2 C T 11: 61,139,714 (GRCm39) V473I probably benign Het
Arfgef3 A T 10: 18,523,663 (GRCm39) I369K possibly damaging Het
Atl2 A G 17: 80,161,260 (GRCm39) probably benign Het
Atp1b3 T C 9: 96,220,762 (GRCm39) I178V possibly damaging Het
Axdnd1 T C 1: 156,205,956 (GRCm39) E520G possibly damaging Het
Bahcc1 A T 11: 120,175,900 (GRCm39) probably benign Het
BB019430 A T 10: 58,540,093 (GRCm39) noncoding transcript Het
BC028528 A T 3: 95,794,646 (GRCm39) probably benign Het
Btbd1 T A 7: 81,450,751 (GRCm39) Q343L probably benign Het
Catsper1 A G 19: 5,389,503 (GRCm39) T473A possibly damaging Het
Ccn4 T C 15: 66,791,059 (GRCm39) L287P probably damaging Het
Chmp6 G A 11: 119,806,349 (GRCm39) probably null Het
Cstdc7 T A 18: 42,306,608 (GRCm39) D58E probably damaging Het
D130040H23Rik T C 8: 69,755,195 (GRCm39) V200A possibly damaging Het
D830013O20Rik C T 12: 73,411,105 (GRCm39) noncoding transcript Het
Dcaf1 T A 9: 106,721,344 (GRCm39) S379T possibly damaging Het
Dcaf4 G A 12: 83,582,762 (GRCm39) probably benign Het
Dhx58 T C 11: 100,586,150 (GRCm39) I624V probably benign Het
Disp3 T C 4: 148,338,708 (GRCm39) E821G probably damaging Het
Dlc1 T A 8: 37,066,594 (GRCm39) E464V probably damaging Het
Dnah10 G A 5: 124,860,898 (GRCm39) V2151I probably damaging Het
Dnah6 C T 6: 73,165,518 (GRCm39) probably benign Het
Dnah8 G A 17: 30,967,639 (GRCm39) G2617D probably benign Het
Dnah9 C A 11: 65,809,630 (GRCm39) E872* probably null Het
Dock9 T C 14: 121,835,077 (GRCm39) Y99C probably damaging Het
Dpy19l3 T A 7: 35,416,071 (GRCm39) I310F probably damaging Het
Fggy A T 4: 95,725,891 (GRCm39) I137F probably damaging Het
Gli2 A G 1: 118,818,013 (GRCm39) probably benign Het
Gm14421 A T 2: 176,748,515 (GRCm39) noncoding transcript Het
Grin2a A G 16: 9,812,685 (GRCm39) probably null Het
Grin2b A G 6: 135,755,646 (GRCm39) probably benign Het
Incenp A G 19: 9,872,243 (GRCm39) S72P probably benign Het
Ipo11 A G 13: 107,046,702 (GRCm39) probably benign Het
Klc3 T A 7: 19,128,851 (GRCm39) N469Y possibly damaging Het
Lrrc42 A G 4: 107,104,702 (GRCm39) S88P probably benign Het
Lrrc49 G A 9: 60,587,883 (GRCm39) T93I probably benign Het
Ltn1 G A 16: 87,202,407 (GRCm39) probably benign Het
Mlycd A T 8: 120,134,380 (GRCm39) Q294L probably damaging Het
Mmrn1 T A 6: 60,952,799 (GRCm39) probably benign Het
Mrpl22 T A 11: 58,062,647 (GRCm39) I19N probably benign Het
Msh3 T A 13: 92,485,717 (GRCm39) K202N probably damaging Het
N4bp2 T C 5: 65,960,916 (GRCm39) probably benign Het
Ncam1 C T 9: 49,479,709 (GRCm39) D90N probably damaging Het
Nckap5 A T 1: 125,952,144 (GRCm39) D1405E possibly damaging Het
Ncoa2 A G 1: 13,256,955 (GRCm39) probably null Het
Ncoa6 TGC TGCGC 2: 155,250,211 (GRCm39) probably null Het
Nlrp1b A T 11: 71,054,925 (GRCm39) W844R probably damaging Het
Nmnat1 G T 4: 149,553,607 (GRCm39) N168K possibly damaging Het
Or5b96 A G 19: 12,867,809 (GRCm39) L44P probably damaging Het
Ost4 T C 5: 31,064,803 (GRCm39) H26R probably damaging Het
Otog G A 7: 45,953,655 (GRCm39) V2638M probably damaging Het
Otogl A T 10: 107,710,391 (GRCm39) I566N probably damaging Het
Pcyt1a T C 16: 32,289,004 (GRCm39) S282P probably damaging Het
Prkcg G A 7: 3,377,635 (GRCm39) E581K probably damaging Het
Ralgps2 A G 1: 156,714,659 (GRCm39) probably null Het
Rnf157 A G 11: 116,245,636 (GRCm39) probably benign Het
Scmh1 T C 4: 120,387,062 (GRCm39) probably benign Het
Sgo2b T C 8: 64,391,417 (GRCm39) H150R possibly damaging Het
Sh2b3 T G 5: 121,967,100 (GRCm39) T5P probably damaging Het
Skint6 A T 4: 112,848,433 (GRCm39) probably benign Het
Slfn10-ps T C 11: 82,926,128 (GRCm39) noncoding transcript Het
Sspo T A 6: 48,471,128 (GRCm39) probably benign Het
Tcp1 T A 17: 13,141,634 (GRCm39) probably benign Het
Tdp2 A G 13: 25,022,222 (GRCm39) M214V probably damaging Het
Tenm4 T G 7: 96,378,547 (GRCm39) probably benign Het
Tmem144 G A 3: 79,746,580 (GRCm39) probably benign Het
Tmem204 A G 17: 25,277,324 (GRCm39) I187T probably damaging Het
Tmem208 T G 8: 106,061,326 (GRCm39) D117E probably benign Het
Tnks1bp1 C T 2: 84,889,565 (GRCm39) P631S possibly damaging Het
Tomm70a T C 16: 56,968,184 (GRCm39) V517A probably damaging Het
Ttc7 T C 17: 87,687,323 (GRCm39) V801A probably damaging Het
Txndc5 A T 13: 38,691,929 (GRCm39) C146S probably damaging Het
Ubac2 A G 14: 122,246,329 (GRCm39) probably benign Het
Ube4b G T 4: 149,444,781 (GRCm39) T493K probably damaging Het
Ufl1 A T 4: 25,256,008 (GRCm39) Y504N probably benign Het
Ugt1a6a T C 1: 88,066,992 (GRCm39) V266A possibly damaging Het
Ugt1a6b T A 1: 88,035,189 (GRCm39) C176S probably damaging Het
Ulk3 T A 9: 57,497,969 (GRCm39) I90N probably damaging Het
Unc13c T C 9: 73,602,174 (GRCm39) I1357M probably benign Het
Vmn1r28 G A 6: 58,242,702 (GRCm39) A182T probably benign Het
Vmn2r114 A G 17: 23,528,800 (GRCm39) probably null Het
Vmn2r91 A C 17: 18,326,399 (GRCm39) N228T probably benign Het
Wdr43 T G 17: 71,938,992 (GRCm39) probably benign Het
Zfp980 A G 4: 145,428,567 (GRCm39) D432G probably benign Het
Other mutations in Zbtb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Zbtb6 APN 2 37,319,343 (GRCm39) missense probably benign 0.38
IGL02981:Zbtb6 APN 2 37,319,176 (GRCm39) nonsense probably null
IGL03390:Zbtb6 APN 2 37,319,584 (GRCm39) missense probably damaging 1.00
R0164:Zbtb6 UTSW 2 37,319,600 (GRCm39) nonsense probably null
R0470:Zbtb6 UTSW 2 37,319,505 (GRCm39) missense probably damaging 0.99
R1472:Zbtb6 UTSW 2 37,319,356 (GRCm39) missense probably benign
R1606:Zbtb6 UTSW 2 37,319,130 (GRCm39) missense probably benign 0.00
R1824:Zbtb6 UTSW 2 37,319,829 (GRCm39) missense probably damaging 1.00
R4594:Zbtb6 UTSW 2 37,319,054 (GRCm39) missense possibly damaging 0.71
R4838:Zbtb6 UTSW 2 37,318,728 (GRCm39) nonsense probably null
R5000:Zbtb6 UTSW 2 37,319,251 (GRCm39) missense probably benign
R5816:Zbtb6 UTSW 2 37,319,227 (GRCm39) missense probably benign 0.01
R6005:Zbtb6 UTSW 2 37,318,977 (GRCm39) missense probably damaging 1.00
R6152:Zbtb6 UTSW 2 37,319,255 (GRCm39) missense probably benign 0.18
R6390:Zbtb6 UTSW 2 37,318,690 (GRCm39) missense probably benign 0.01
R7657:Zbtb6 UTSW 2 37,319,087 (GRCm39) missense probably benign
R7866:Zbtb6 UTSW 2 37,319,577 (GRCm39) missense probably damaging 1.00
R8310:Zbtb6 UTSW 2 37,319,896 (GRCm39) missense probably benign 0.00
R8969:Zbtb6 UTSW 2 37,318,677 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGTACAAGGCTGTGAAAACTGC -3'
(R):5'- AGGGGCACAAGGTGATTTTGGC -3'

Sequencing Primer
(F):5'- CTGTACTAATGGATTCTACATGGAGG -3'
(R):5'- GATTTTGGCTGCTTGCTCCAC -3'
Posted On 2013-04-16