Incidental Mutation 'R2233:Xylt2'
ID 240200
Institutional Source Beutler Lab
Gene Symbol Xylt2
Ensembl Gene ENSMUSG00000020868
Gene Name xylosyltransferase II
Synonyms E030002B02Rik
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock # R2233 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 94663851-94677515 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 94669996 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 239 (V239M)
Ref Sequence ENSEMBL: ENSMUSP00000122581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116349] [ENSMUST00000146693] [ENSMUST00000150377] [ENSMUST00000153485]
AlphaFold Q9EPL0
Predicted Effect possibly damaging
Transcript: ENSMUST00000116349
AA Change: V239M

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112052
Gene: ENSMUSG00000020868
AA Change: V239M

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.9e-60 PFAM
Pfam:Xylo_C 519 699 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146693
Predicted Effect probably benign
Transcript: ENSMUST00000150377
SMART Domains Protein: ENSMUSP00000134495
Gene: ENSMUSG00000020868

DomainStartEndE-ValueType
Pfam:Xylo_C 31 97 2.1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153485
AA Change: V239M

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122581
Gene: ENSMUSG00000020868
AA Change: V239M

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.1e-59 PFAM
Pfam:Xylo_C 519 594 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154830
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isoform of xylosyltransferase, which belongs to a family of glycosyltransferases. This enzyme transfers xylose from UDP-xylose to specific serine residues of the core protein and initiates the biosynthesis of glycosaminoglycan chains in proteoglycans including chondroitin sulfate, heparan sulfate, heparin and dermatan sulfate. The enzyme activity, which is increased in scleroderma patients, is a diagnostic marker for the determination of sclerotic activity in systemic sclerosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele lack most liver proteoglycans and develop many aspects of polycystic liver and kidney disease, including biliary tract hyperplasia, liver fibrosis, biliary cysts, renal tubule dilation, basement membrane abnormalities and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Xylt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02048:Xylt2 APN 11 94666345 missense possibly damaging 0.61
IGL02421:Xylt2 APN 11 94667762 missense possibly damaging 0.45
P0040:Xylt2 UTSW 11 94668791 missense possibly damaging 0.46
PIT4585001:Xylt2 UTSW 11 94666240 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0313:Xylt2 UTSW 11 94669894 splice site probably benign
R0449:Xylt2 UTSW 11 94666333 missense probably benign 0.22
R0511:Xylt2 UTSW 11 94669936 nonsense probably null
R1483:Xylt2 UTSW 11 94669567 missense probably benign 0.04
R1511:Xylt2 UTSW 11 94670433 missense probably damaging 1.00
R1565:Xylt2 UTSW 11 94667594 missense probably benign
R1616:Xylt2 UTSW 11 94668209 missense probably damaging 1.00
R1702:Xylt2 UTSW 11 94668745 missense probably damaging 0.98
R1712:Xylt2 UTSW 11 94668749 missense possibly damaging 0.88
R2234:Xylt2 UTSW 11 94669996 missense possibly damaging 0.71
R4534:Xylt2 UTSW 11 94666350 missense probably benign 0.02
R4702:Xylt2 UTSW 11 94669529 missense possibly damaging 0.83
R4768:Xylt2 UTSW 11 94670472 missense probably benign 0.06
R5032:Xylt2 UTSW 11 94670016 missense probably damaging 0.99
R5237:Xylt2 UTSW 11 94667127 missense probably benign
R5281:Xylt2 UTSW 11 94668790 missense probably benign 0.30
R5949:Xylt2 UTSW 11 94668483 missense probably damaging 1.00
R6950:Xylt2 UTSW 11 94667629 missense probably benign
R7041:Xylt2 UTSW 11 94667582 critical splice donor site probably null
R8987:Xylt2 UTSW 11 94670452 missense probably damaging 1.00
R9029:Xylt2 UTSW 11 94664636 missense probably damaging 1.00
R9088:Xylt2 UTSW 11 94670403 missense probably benign 0.32
R9285:Xylt2 UTSW 11 94667710 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CATGCCACCTTATGCTTGAC -3'
(R):5'- GCTCTGAGTCTAGGCTTCTG -3'

Sequencing Primer
(F):5'- ATGCTTGACCATGCTGGAC -3'
(R):5'- CTTCTGTTAGGAGGCAAGCAG -3'
Posted On 2014-10-15