Mutagenetix > Incidental Mutations

Incidental Mutation 'R2233:Atad2b'

240202

Institutional Source

Beutler Lab

Gene Symbol

Atad2b

Ensembl Gene

ENSMUSG00000052812

Gene Name

ATPase family, AAA domain containing 2B

Synonyms

D530031C13Rik, 1110014E10Rik

MMRRC Submission

040234-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2233 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4917353-5047394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 5006745 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Cysteine at position 867 (F867C)

Ref Sequence

ENSEMBL: ENSMUSP00000047445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045664
AA Change: F867C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: F867C

Domain	Start	End	E-Value	Type
low complexity region	13	54	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
low complexity region	252	278	N/A	INTRINSIC
AAA	432	573	4.56e-20	SMART
SCOP:d1e32a2	771	912	3e-4	SMART
BROMO	958	1070	4.24e-20	SMART
low complexity region	1135	1144	N/A	INTRINSIC
low complexity region	1230	1253	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218859

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	A	G	1: 63,545,512	I360V	probably benign	Het
Adarb1	A	G	10: 77,317,349	V322A	probably damaging	Het
Ccdc24	T	C	4: 117,869,916	K79R	possibly damaging	Het
Cfap44	A	G	16: 44,451,525	I1214V	probably benign	Het
Chrm4	A	G	2: 91,928,530	S428G	probably benign	Het
Chrnb1	A	T	11: 69,795,602	I64N	probably damaging	Het
Crh	A	T	3: 19,693,932	M182K	probably damaging	Het
Dazap1	A	G	10: 80,277,599	K110E	possibly damaging	Het
Dhx16	T	C	17: 35,887,886	C737R	probably damaging	Het
Dst	A	G	1: 34,274,262	E6384G	probably damaging	Het
Dync1i2	C	T	2: 71,249,420	Q419*	probably null	Het
E2f4	T	A	8: 105,298,651	V121E	probably damaging	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	C	6: 23,246,003	T388A	probably damaging	Het
Gimap6	T	A	6: 48,704,484	H72L	possibly damaging	Het
Gm11149	A	G	9: 49,562,146		probably benign	Het
Gm12695	C	T	4: 96,724,029	R499Q	probably damaging	Het
Grhl1	A	G	12: 24,608,511	D385G	probably damaging	Het
Hyou1	C	T	9: 44,389,091	T855M	probably benign	Het
Igf1r	T	A	7: 68,212,080	N1129K	probably damaging	Het
Iglon5	T	C	7: 43,480,638	E34G	probably damaging	Het
Kcnab1	T	A	3: 65,319,467	V189D	probably damaging	Het
Kifap3	T	A	1: 163,856,065	D438E	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrrc41	G	A	4: 116,096,385	R756Q	possibly damaging	Het
Lrrc49	A	T	9: 60,598,157	F538L	possibly damaging	Het
Nphp3	G	A	9: 104,037,376	R1052H	probably benign	Het
Nynrin	G	A	14: 55,872,067	V1544I	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1154	G	A	2: 87,903,475	S67F	probably damaging	Het
Olfr1346	T	C	7: 6,474,442	S111P	possibly damaging	Het
Osbpl6	T	C	2: 76,586,769	F577L	probably damaging	Het
Otc	A	G	X: 10,303,367	Q216R	probably benign	Het
Ppp1r12a	A	G	10: 108,198,919	I108M	possibly damaging	Het
Prl7a1	C	A	13: 27,642,419		probably null	Het
Prss16	T	C	13: 22,009,409	D72G	possibly damaging	Het
Qrsl1	T	C	10: 43,896,096	K33E	probably benign	Het
Rabepk	A	T	2: 34,795,234	I58N	possibly damaging	Het
Ralgapa1	A	T	12: 55,717,071	H1403Q	probably benign	Het
Rhobtb3	C	A	13: 75,872,365	C606F	possibly damaging	Het
Rnf216	G	A	5: 143,090,926	H68Y	probably benign	Het
Scap	T	C	9: 110,381,593	C998R	probably damaging	Het
Scgb1b27	T	C	7: 34,021,824	Y46H	probably damaging	Het
Sel1l2	T	C	2: 140,244,165	Y502C	probably damaging	Het
Sf3a2	G	T	10: 80,802,829	A95S	probably benign	Het
Sis	A	T	3: 72,913,194	F1412L	probably benign	Het
Slc25a29	A	T	12: 108,835,661	C9S	possibly damaging	Het
Snap91	T	C	9: 86,798,571	T427A	probably benign	Het
St3gal6	A	G	16: 58,473,534	F211L	probably damaging	Het
Stab1	G	A	14: 31,161,880	S240F	probably benign	Het
Sun3	T	A	11: 9,023,371	K109*	probably null	Het
Syne1	T	C	10: 5,041,484	N8410S	probably benign	Het
Tbx18	G	T	9: 87,724,350	S247R	probably damaging	Het
Tenm3	T	C	8: 48,276,169	I1601V	probably benign	Het
Tmem135	T	C	7: 89,154,074	N297S	probably damaging	Het
Tnk1	C	T	11: 69,855,191		probably null	Het
Txnl4b	A	G	8: 109,568,919		probably benign	Het
Uck1	T	C	2: 32,258,303	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,049,665	H61L	possibly damaging	Het
Xylt2	C	T	11: 94,669,996	V239M	possibly damaging	Het
Zmpste24	T	C	4: 121,097,965	D12G	probably benign	Het
Zscan25	A	G	5: 145,283,692	Y99C	probably damaging	Het

Other mutations in Atad2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Atad2b	APN	12	5024593	missense	probably damaging	1.00
IGL00917:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01011:Atad2b	APN	12	4965984	missense	probably benign	0.01
IGL01092:Atad2b	APN	12	5017987	missense	probably damaging	0.98
IGL01604:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01924:Atad2b	APN	12	5034093	missense	probably damaging	1.00
IGL02197:Atad2b	APN	12	5018056	missense	possibly damaging	0.84
IGL02397:Atad2b	APN	12	4974046	missense	probably damaging	1.00
IGL02404:Atad2b	APN	12	4941972	missense	probably benign	0.08
IGL02517:Atad2b	APN	12	5018037	missense	probably benign	0.07
IGL02726:Atad2b	APN	12	4974003	nonsense	probably null
IGL02896:Atad2b	APN	12	4958151	missense	probably damaging	1.00
IGL03227:Atad2b	APN	12	5006715	missense	probably damaging	1.00
IGL03265:Atad2b	APN	12	5024628	missense	probably benign	0.24
K3955:Atad2b	UTSW	12	4954536	splice site	probably benign
P0038:Atad2b	UTSW	12	4954536	splice site	probably benign
PIT4418001:Atad2b	UTSW	12	5024587	missense	probably benign	0.07
PIT4431001:Atad2b	UTSW	12	5031795	missense	possibly damaging	0.77
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0124:Atad2b	UTSW	12	4952676	missense	probably benign	0.23
R0462:Atad2b	UTSW	12	4941973	missense	possibly damaging	0.79
R0483:Atad2b	UTSW	12	4945035	splice site	probably benign
R0617:Atad2b	UTSW	12	4937401	missense	probably benign	0.43
R0894:Atad2b	UTSW	12	4965915	missense	probably damaging	1.00
R0942:Atad2b	UTSW	12	5024591	missense	probably damaging	1.00
R0960:Atad2b	UTSW	12	5006593	splice site	probably benign
R0973:Atad2b	UTSW	12	5031784	missense	probably benign	0.00
R1306:Atad2b	UTSW	12	4974239	missense	probably benign	0.08
R1530:Atad2b	UTSW	12	4942018	nonsense	probably null
R1678:Atad2b	UTSW	12	4965899	missense	possibly damaging	0.91
R1689:Atad2b	UTSW	12	5034575	nonsense	probably null
R1826:Atad2b	UTSW	12	4974094	missense	probably benign	0.00
R1996:Atad2b	UTSW	12	4990883	missense	probably benign	0.01
R2235:Atad2b	UTSW	12	5006745	missense	probably damaging	1.00
R2943:Atad2b	UTSW	12	4942067	missense	probably damaging	0.98
R3161:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3162:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3162:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3508:Atad2b	UTSW	12	4950595	critical splice donor site	probably null
R4239:Atad2b	UTSW	12	4985710	missense	probably benign	0.05
R4401:Atad2b	UTSW	12	4940145	missense	probably damaging	0.99
R4558:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4559:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4573:Atad2b	UTSW	12	4954663	splice site	probably null
R4639:Atad2b	UTSW	12	5018053	missense	probably damaging	1.00
R4847:Atad2b	UTSW	12	4944901	splice site	probably null
R4850:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4851:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4979:Atad2b	UTSW	12	5034513	missense	probably damaging	1.00
R5024:Atad2b	UTSW	12	4937534	missense	probably benign	0.45
R5305:Atad2b	UTSW	12	4965855	missense	probably damaging	1.00
R5405:Atad2b	UTSW	12	4940098	missense	possibly damaging	0.87
R5627:Atad2b	UTSW	12	4917911	missense	probably benign	0.01
R5754:Atad2b	UTSW	12	5010351	missense	probably benign	0.01
R6163:Atad2b	UTSW	12	4954593	missense	probably benign	0.00
R6371:Atad2b	UTSW	12	4973970	missense	probably damaging	1.00
R6374:Atad2b	UTSW	12	5018002	missense	probably damaging	1.00
R6399:Atad2b	UTSW	12	4957558	missense	probably damaging	1.00
R6433:Atad2b	UTSW	12	4952642	missense	possibly damaging	0.89
R6546:Atad2b	UTSW	12	4990949	missense	probably damaging	1.00
R6617:Atad2b	UTSW	12	5024668	missense	probably benign	0.00
R7199:Atad2b	UTSW	12	5017992	missense	probably damaging	1.00
R7267:Atad2b	UTSW	12	5027105	nonsense	probably null
R7405:Atad2b	UTSW	12	4943232	missense	probably benign	0.08
R7460:Atad2b	UTSW	12	4952660	missense	probably benign	0.28
R7568:Atad2b	UTSW	12	5010390	critical splice donor site	probably null
R7593:Atad2b	UTSW	12	5031726	missense	probably benign	0.16
R7648:Atad2b	UTSW	12	5027182	critical splice donor site	probably null
R8253:Atad2b	UTSW	12	4974159	missense	possibly damaging	0.54
R8253:Atad2b	UTSW	12	4974160	missense	probably benign	0.02
R8708:Atad2b	UTSW	12	4961253	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAATTTGAGCTTTTAATCACTGG -3'
(R):5'- AGGCTCAGCTTTAGGCACAG -3'

Sequencing Primer
(F):5'- GTTCTTTCCCTAGATATTTCGAGAAG -3'
(R):5'- GCTCAGCTTTAGGCACAGAAGTTTC -3'

Posted On

2014-10-15