Incidental Mutation 'R2233:Grhl1'
ID 240203
Institutional Source Beutler Lab
Gene Symbol Grhl1
Ensembl Gene ENSMUSG00000020656
Gene Name grainyhead like transcription factor 1
Synonyms LBP-32, p70 MGR, p61 MGR, Tcfcp2l2
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2233 (G1)
Quality Score 207
Status Not validated
Chromosome 12
Chromosomal Location 24572283-24617391 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24608511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 385 (D385G)
Ref Sequence ENSEMBL: ENSMUSP00000020985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020985] [ENSMUST00000085553]
AlphaFold Q921D9
Predicted Effect probably damaging
Transcript: ENSMUST00000020985
AA Change: D385G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020985
Gene: ENSMUSG00000020656
AA Change: D385G

DomainStartEndE-ValueType
Pfam:CP2 133 362 1.8e-87 PFAM
low complexity region 406 421 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085553
AA Change: D467G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082689
Gene: ENSMUSG00000020656
AA Change: D467G

DomainStartEndE-ValueType
Pfam:CP2 228 442 1.9e-82 PFAM
low complexity region 488 503 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223442
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein can exist as a homodimer or can form heterodimers with sister-of-mammalian grainyhead or brother-of-mammalian grainyhead. This protein functions as a transcription factor during development. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display alopecia or sparse hair, abnormal hair follicle root sheaths, thickening of the cornified layer on the paws, and postnatal growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Grhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Grhl1 APN 12 24612170 missense probably damaging 1.00
IGL01104:Grhl1 APN 12 24584454 missense probably damaging 1.00
IGL01335:Grhl1 APN 12 24608058 missense probably damaging 1.00
IGL01660:Grhl1 APN 12 24608578 splice site probably null
IGL01725:Grhl1 APN 12 24609748 splice site probably benign
IGL02869:Grhl1 APN 12 24581491 missense probably damaging 1.00
bandit UTSW 12 24578027 missense probably benign 0.31
cembalo UTSW 12 24586152 critical splice donor site probably null
gamba UTSW 12 24612245 splice site probably benign
Spinnet UTSW 12 24584946 critical splice donor site probably null
R0048:Grhl1 UTSW 12 24612151 splice site probably benign
R0373:Grhl1 UTSW 12 24581515 missense probably benign 0.00
R0432:Grhl1 UTSW 12 24582919 missense probably benign 0.29
R0442:Grhl1 UTSW 12 24612170 missense probably damaging 1.00
R1531:Grhl1 UTSW 12 24582963 critical splice donor site probably null
R1646:Grhl1 UTSW 12 24611861 missense possibly damaging 0.64
R1874:Grhl1 UTSW 12 24586156 splice site probably benign
R1892:Grhl1 UTSW 12 24584910 missense probably damaging 1.00
R1908:Grhl1 UTSW 12 24608556 missense probably damaging 0.99
R2051:Grhl1 UTSW 12 24586152 critical splice donor site probably null
R2199:Grhl1 UTSW 12 24612170 missense probably damaging 1.00
R3803:Grhl1 UTSW 12 24584919 missense probably damaging 1.00
R3864:Grhl1 UTSW 12 24615930 makesense probably null
R4227:Grhl1 UTSW 12 24611851 missense probably benign
R4682:Grhl1 UTSW 12 24608433 missense probably benign 0.00
R4709:Grhl1 UTSW 12 24586133 missense possibly damaging 0.57
R5096:Grhl1 UTSW 12 24603050 missense probably damaging 1.00
R5149:Grhl1 UTSW 12 24612179 small deletion probably benign
R5580:Grhl1 UTSW 12 24609740 missense probably benign 0.00
R6035:Grhl1 UTSW 12 24608450 missense probably benign 0.00
R6035:Grhl1 UTSW 12 24608450 missense probably benign 0.00
R6110:Grhl1 UTSW 12 24580747 splice site probably null
R6351:Grhl1 UTSW 12 24584858 missense probably damaging 0.98
R7018:Grhl1 UTSW 12 24575997 missense possibly damaging 0.47
R8211:Grhl1 UTSW 12 24586152 critical splice donor site probably null
R8723:Grhl1 UTSW 12 24612245 splice site probably benign
R8898:Grhl1 UTSW 12 24584946 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAACCCTGAGTTTCTGCTGC -3'
(R):5'- GCTCAGTAACTGGTTAAGTGCC -3'

Sequencing Primer
(F):5'- AGCTCACTTTATAGACCAGGCTGG -3'
(R):5'- AACTGGTTAAGTGCCACTGC -3'
Posted On 2014-10-15