Mutagenetix > Incidental Mutations

Incidental Mutation 'R2233:Grhl1'

240203

Institutional Source

Beutler Lab

Gene Symbol

Grhl1

Ensembl Gene

ENSMUSG00000020656

Gene Name

grainyhead like transcription factor 1

Synonyms

LBP-32, p70 MGR, p61 MGR, Tcfcp2l2

MMRRC Submission

040234-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2233 (G1)

Quality Score

207

Status

Not validated

Chromosome

Chromosomal Location

24572283-24617391 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24608511 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 385 (D385G)

Ref Sequence

ENSEMBL: ENSMUSP00000020985 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020985] [ENSMUST00000085553]

AlphaFold

Q921D9

Predicted Effect

probably damaging
Transcript: ENSMUST00000020985
AA Change: D385G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020985
Gene: ENSMUSG00000020656
AA Change: D385G

Domain	Start	End	E-Value	Type
Pfam:CP2	133	362	1.8e-87	PFAM
low complexity region	406	421	N/A	INTRINSIC
low complexity region	488	500	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000085553
AA Change: D467G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082689
Gene: ENSMUSG00000020656
AA Change: D467G

Domain	Start	End	E-Value	Type
Pfam:CP2	228	442	1.9e-82	PFAM
low complexity region	488	503	N/A	INTRINSIC
low complexity region	570	582	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223442

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the grainyhead family of transcription factors. The encoded protein can exist as a homodimer or can form heterodimers with sister-of-mammalian grainyhead or brother-of-mammalian grainyhead. This protein functions as a transcription factor during development. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a null allele display alopecia or sparse hair, abnormal hair follicle root sheaths, thickening of the cornified layer on the paws, and postnatal growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	A	G	1: 63,545,512	I360V	probably benign	Het
Adarb1	A	G	10: 77,317,349	V322A	probably damaging	Het
Atad2b	T	G	12: 5,006,745	F867C	probably damaging	Het
Ccdc24	T	C	4: 117,869,916	K79R	possibly damaging	Het
Cfap44	A	G	16: 44,451,525	I1214V	probably benign	Het
Chrm4	A	G	2: 91,928,530	S428G	probably benign	Het
Chrnb1	A	T	11: 69,795,602	I64N	probably damaging	Het
Crh	A	T	3: 19,693,932	M182K	probably damaging	Het
Dazap1	A	G	10: 80,277,599	K110E	possibly damaging	Het
Dhx16	T	C	17: 35,887,886	C737R	probably damaging	Het
Dst	A	G	1: 34,274,262	E6384G	probably damaging	Het
Dync1i2	C	T	2: 71,249,420	Q419*	probably null	Het
E2f4	T	A	8: 105,298,651	V121E	probably damaging	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	C	6: 23,246,003	T388A	probably damaging	Het
Gimap6	T	A	6: 48,704,484	H72L	possibly damaging	Het
Gm11149	A	G	9: 49,562,146		probably benign	Het
Gm12695	C	T	4: 96,724,029	R499Q	probably damaging	Het
Hyou1	C	T	9: 44,389,091	T855M	probably benign	Het
Igf1r	T	A	7: 68,212,080	N1129K	probably damaging	Het
Iglon5	T	C	7: 43,480,638	E34G	probably damaging	Het
Kcnab1	T	A	3: 65,319,467	V189D	probably damaging	Het
Kifap3	T	A	1: 163,856,065	D438E	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrrc41	G	A	4: 116,096,385	R756Q	possibly damaging	Het
Lrrc49	A	T	9: 60,598,157	F538L	possibly damaging	Het
Nphp3	G	A	9: 104,037,376	R1052H	probably benign	Het
Nynrin	G	A	14: 55,872,067	V1544I	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1154	G	A	2: 87,903,475	S67F	probably damaging	Het
Olfr1346	T	C	7: 6,474,442	S111P	possibly damaging	Het
Osbpl6	T	C	2: 76,586,769	F577L	probably damaging	Het
Otc	A	G	X: 10,303,367	Q216R	probably benign	Het
Ppp1r12a	A	G	10: 108,198,919	I108M	possibly damaging	Het
Prl7a1	C	A	13: 27,642,419		probably null	Het
Prss16	T	C	13: 22,009,409	D72G	possibly damaging	Het
Qrsl1	T	C	10: 43,896,096	K33E	probably benign	Het
Rabepk	A	T	2: 34,795,234	I58N	possibly damaging	Het
Ralgapa1	A	T	12: 55,717,071	H1403Q	probably benign	Het
Rhobtb3	C	A	13: 75,872,365	C606F	possibly damaging	Het
Rnf216	G	A	5: 143,090,926	H68Y	probably benign	Het
Scap	T	C	9: 110,381,593	C998R	probably damaging	Het
Scgb1b27	T	C	7: 34,021,824	Y46H	probably damaging	Het
Sel1l2	T	C	2: 140,244,165	Y502C	probably damaging	Het
Sf3a2	G	T	10: 80,802,829	A95S	probably benign	Het
Sis	A	T	3: 72,913,194	F1412L	probably benign	Het
Slc25a29	A	T	12: 108,835,661	C9S	possibly damaging	Het
Snap91	T	C	9: 86,798,571	T427A	probably benign	Het
St3gal6	A	G	16: 58,473,534	F211L	probably damaging	Het
Stab1	G	A	14: 31,161,880	S240F	probably benign	Het
Sun3	T	A	11: 9,023,371	K109*	probably null	Het
Syne1	T	C	10: 5,041,484	N8410S	probably benign	Het
Tbx18	G	T	9: 87,724,350	S247R	probably damaging	Het
Tenm3	T	C	8: 48,276,169	I1601V	probably benign	Het
Tmem135	T	C	7: 89,154,074	N297S	probably damaging	Het
Tnk1	C	T	11: 69,855,191		probably null	Het
Txnl4b	A	G	8: 109,568,919		probably benign	Het
Uck1	T	C	2: 32,258,303	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,049,665	H61L	possibly damaging	Het
Xylt2	C	T	11: 94,669,996	V239M	possibly damaging	Het
Zmpste24	T	C	4: 121,097,965	D12G	probably benign	Het
Zscan25	A	G	5: 145,283,692	Y99C	probably damaging	Het

Other mutations in Grhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Grhl1	APN	12	24612170	missense	probably damaging	1.00
IGL01104:Grhl1	APN	12	24584454	missense	probably damaging	1.00
IGL01335:Grhl1	APN	12	24608058	missense	probably damaging	1.00
IGL01660:Grhl1	APN	12	24608578	splice site	probably null
IGL01725:Grhl1	APN	12	24609748	splice site	probably benign
IGL02869:Grhl1	APN	12	24581491	missense	probably damaging	1.00
bandit	UTSW	12	24578027	missense	probably benign	0.31
cembalo	UTSW	12	24586152	critical splice donor site	probably null
gamba	UTSW	12	24612245	splice site	probably benign
Spinnet	UTSW	12	24584946	critical splice donor site	probably null
R0048:Grhl1	UTSW	12	24612151	splice site	probably benign
R0373:Grhl1	UTSW	12	24581515	missense	probably benign	0.00
R0432:Grhl1	UTSW	12	24582919	missense	probably benign	0.29
R0442:Grhl1	UTSW	12	24612170	missense	probably damaging	1.00
R1531:Grhl1	UTSW	12	24582963	critical splice donor site	probably null
R1646:Grhl1	UTSW	12	24611861	missense	possibly damaging	0.64
R1874:Grhl1	UTSW	12	24586156	splice site	probably benign
R1892:Grhl1	UTSW	12	24584910	missense	probably damaging	1.00
R1908:Grhl1	UTSW	12	24608556	missense	probably damaging	0.99
R2051:Grhl1	UTSW	12	24586152	critical splice donor site	probably null
R2199:Grhl1	UTSW	12	24612170	missense	probably damaging	1.00
R3803:Grhl1	UTSW	12	24584919	missense	probably damaging	1.00
R3864:Grhl1	UTSW	12	24615930	makesense	probably null
R4227:Grhl1	UTSW	12	24611851	missense	probably benign
R4682:Grhl1	UTSW	12	24608433	missense	probably benign	0.00
R4709:Grhl1	UTSW	12	24586133	missense	possibly damaging	0.57
R5096:Grhl1	UTSW	12	24603050	missense	probably damaging	1.00
R5149:Grhl1	UTSW	12	24612179	small deletion	probably benign
R5580:Grhl1	UTSW	12	24609740	missense	probably benign	0.00
R6035:Grhl1	UTSW	12	24608450	missense	probably benign	0.00
R6035:Grhl1	UTSW	12	24608450	missense	probably benign	0.00
R6110:Grhl1	UTSW	12	24580747	splice site	probably null
R6351:Grhl1	UTSW	12	24584858	missense	probably damaging	0.98
R7018:Grhl1	UTSW	12	24575997	missense	possibly damaging	0.47
R8211:Grhl1	UTSW	12	24586152	critical splice donor site	probably null
R8723:Grhl1	UTSW	12	24612245	splice site	probably benign
R8898:Grhl1	UTSW	12	24584946	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAACCCTGAGTTTCTGCTGC -3'
(R):5'- GCTCAGTAACTGGTTAAGTGCC -3'

Sequencing Primer
(F):5'- AGCTCACTTTATAGACCAGGCTGG -3'
(R):5'- AACTGGTTAAGTGCCACTGC -3'

Posted On

2014-10-15