Incidental Mutation 'R2233:Slc25a29'
ID240205
Institutional Source Beutler Lab
Gene Symbol Slc25a29
Ensembl Gene ENSMUSG00000021265
Gene Namesolute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29
SynonymsCACL, mCACL, C030003J19Rik
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2233 (G1)
Quality Score183
Status Not validated
Chromosome12
Chromosomal Location108825873-108835883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108835661 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 9 (C9S)
Ref Sequence ENSEMBL: ENSMUSP00000021693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021693]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021693
AA Change: C9S

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021693
Gene: ENSMUSG00000021265
AA Change: C9S

DomainStartEndE-ValueType
Pfam:Mito_carr 1 91 1.5e-21 PFAM
Pfam:Mito_carr 88 182 4.6e-25 PFAM
Pfam:Mito_carr 185 279 1.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223296
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-encoded mitochondrial protein that is a member of the large family of solute carrier family 25 (SLC25) mitochondrial transporters. The members of this superfamily are involved in numerous metabolic pathways and cell functions. This gene product was previously reported to be a mitochondrial carnitine-acylcarnitine-like (CACL) translocase (PMID:128829710) or an ornithine transporter (designated ORNT3, PMID:19287344), however, a recent study characterized the main role of this protein as a mitochondrial transporter of basic amino acids, with a preference for arginine and lysine (PMID:24652292). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dhx16 T C 17: 35,887,886 C737R probably damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Slc25a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03287:Slc25a29 APN 12 108831209 missense possibly damaging 0.49
R0116:Slc25a29 UTSW 12 108827091 missense possibly damaging 0.94
R1876:Slc25a29 UTSW 12 108827711 missense probably damaging 0.98
R2094:Slc25a29 UTSW 12 108827432 missense probably damaging 1.00
R2276:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2277:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2279:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2383:Slc25a29 UTSW 12 108827008 missense probably damaging 1.00
R4366:Slc25a29 UTSW 12 108831171 intron probably benign
Predicted Primers PCR Primer
(F):5'- CAATGCATGGGAAGTGCTGG -3'
(R):5'- CCAGGGGAGTGCTTTTCTAG -3'

Sequencing Primer
(F):5'- AGCCTTCTAGGAGGTCGC -3'
(R):5'- TTCTAGGAGTCGCCATCCAG -3'
Posted On2014-10-15