Mutagenetix > Incidental Mutations

Incidental Mutation 'R2233:Prss16'

240206

Institutional Source

Beutler Lab

Gene Symbol

Prss16

Ensembl Gene

ENSMUSG00000006179

Gene Name

protease, serine 16 (thymus)

Synonyms

TSSP

MMRRC Submission

040234-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2233 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22002173-22009742 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22009409 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 72 (D72G)

Ref Sequence

ENSEMBL: ENSMUSP00000006341 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006341] [ENSMUST00000150547]

AlphaFold

Q9QXE5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006341
AA Change: D72G

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000006341
Gene: ENSMUSG00000006179
AA Change: D72G

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
low complexity region	40	53	N/A	INTRINSIC
Pfam:Peptidase_S28	63	493	1.9e-157	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130585

Predicted Effect

probably benign
Transcript: ENSMUST00000150547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223857

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine protease expressed exclusively in the thymus. It is thought to play a role in the alternative antigen presenting pathway used by cortical thymic epithelial cells during the positive selection of T cells. The gene is found in the large histone gene cluster on chromosome 6, near the major histocompatibility complex (MHC) class I region. A second transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable with no gross abnormalities and normal T cell development and activation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	A	G	1: 63,545,512	I360V	probably benign	Het
Adarb1	A	G	10: 77,317,349	V322A	probably damaging	Het
Atad2b	T	G	12: 5,006,745	F867C	probably damaging	Het
Ccdc24	T	C	4: 117,869,916	K79R	possibly damaging	Het
Cfap44	A	G	16: 44,451,525	I1214V	probably benign	Het
Chrm4	A	G	2: 91,928,530	S428G	probably benign	Het
Chrnb1	A	T	11: 69,795,602	I64N	probably damaging	Het
Crh	A	T	3: 19,693,932	M182K	probably damaging	Het
Dazap1	A	G	10: 80,277,599	K110E	possibly damaging	Het
Dhx16	T	C	17: 35,887,886	C737R	probably damaging	Het
Dst	A	G	1: 34,274,262	E6384G	probably damaging	Het
Dync1i2	C	T	2: 71,249,420	Q419*	probably null	Het
E2f4	T	A	8: 105,298,651	V121E	probably damaging	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	C	6: 23,246,003	T388A	probably damaging	Het
Gimap6	T	A	6: 48,704,484	H72L	possibly damaging	Het
Gm11149	A	G	9: 49,562,146		probably benign	Het
Gm12695	C	T	4: 96,724,029	R499Q	probably damaging	Het
Grhl1	A	G	12: 24,608,511	D385G	probably damaging	Het
Hyou1	C	T	9: 44,389,091	T855M	probably benign	Het
Igf1r	T	A	7: 68,212,080	N1129K	probably damaging	Het
Iglon5	T	C	7: 43,480,638	E34G	probably damaging	Het
Kcnab1	T	A	3: 65,319,467	V189D	probably damaging	Het
Kifap3	T	A	1: 163,856,065	D438E	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrrc41	G	A	4: 116,096,385	R756Q	possibly damaging	Het
Lrrc49	A	T	9: 60,598,157	F538L	possibly damaging	Het
Nphp3	G	A	9: 104,037,376	R1052H	probably benign	Het
Nynrin	G	A	14: 55,872,067	V1544I	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1154	G	A	2: 87,903,475	S67F	probably damaging	Het
Olfr1346	T	C	7: 6,474,442	S111P	possibly damaging	Het
Osbpl6	T	C	2: 76,586,769	F577L	probably damaging	Het
Otc	A	G	X: 10,303,367	Q216R	probably benign	Het
Ppp1r12a	A	G	10: 108,198,919	I108M	possibly damaging	Het
Prl7a1	C	A	13: 27,642,419		probably null	Het
Qrsl1	T	C	10: 43,896,096	K33E	probably benign	Het
Rabepk	A	T	2: 34,795,234	I58N	possibly damaging	Het
Ralgapa1	A	T	12: 55,717,071	H1403Q	probably benign	Het
Rhobtb3	C	A	13: 75,872,365	C606F	possibly damaging	Het
Rnf216	G	A	5: 143,090,926	H68Y	probably benign	Het
Scap	T	C	9: 110,381,593	C998R	probably damaging	Het
Scgb1b27	T	C	7: 34,021,824	Y46H	probably damaging	Het
Sel1l2	T	C	2: 140,244,165	Y502C	probably damaging	Het
Sf3a2	G	T	10: 80,802,829	A95S	probably benign	Het
Sis	A	T	3: 72,913,194	F1412L	probably benign	Het
Slc25a29	A	T	12: 108,835,661	C9S	possibly damaging	Het
Snap91	T	C	9: 86,798,571	T427A	probably benign	Het
St3gal6	A	G	16: 58,473,534	F211L	probably damaging	Het
Stab1	G	A	14: 31,161,880	S240F	probably benign	Het
Sun3	T	A	11: 9,023,371	K109*	probably null	Het
Syne1	T	C	10: 5,041,484	N8410S	probably benign	Het
Tbx18	G	T	9: 87,724,350	S247R	probably damaging	Het
Tenm3	T	C	8: 48,276,169	I1601V	probably benign	Het
Tmem135	T	C	7: 89,154,074	N297S	probably damaging	Het
Tnk1	C	T	11: 69,855,191		probably null	Het
Txnl4b	A	G	8: 109,568,919		probably benign	Het
Uck1	T	C	2: 32,258,303	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,049,665	H61L	possibly damaging	Het
Xylt2	C	T	11: 94,669,996	V239M	possibly damaging	Het
Zmpste24	T	C	4: 121,097,965	D12G	probably benign	Het
Zscan25	A	G	5: 145,283,692	Y99C	probably damaging	Het

Other mutations in Prss16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02025:Prss16	APN	13	22003021	missense	probably damaging	0.99
IGL02272:Prss16	APN	13	22003035	missense	probably damaging	0.96
IGL02383:Prss16	APN	13	22009527	missense	probably benign	0.00
IGL02892:Prss16	APN	13	22003050	missense	probably benign	0.03
IGL03325:Prss16	APN	13	22003247	missense	possibly damaging	0.90
BB001:Prss16	UTSW	13	22008664	missense	probably damaging	0.99
BB011:Prss16	UTSW	13	22008664	missense	probably damaging	0.99
R0645:Prss16	UTSW	13	22009376	unclassified	probably benign
R0970:Prss16	UTSW	13	22005117	missense	probably damaging	1.00
R1146:Prss16	UTSW	13	22006968	unclassified	probably benign
R1292:Prss16	UTSW	13	22009521	nonsense	probably null
R1371:Prss16	UTSW	13	22008686	unclassified	probably benign
R1525:Prss16	UTSW	13	22009443	missense	possibly damaging	0.50
R1624:Prss16	UTSW	13	22003313	missense	probably benign	0.31
R5147:Prss16	UTSW	13	22006094	missense	possibly damaging	0.70
R5670:Prss16	UTSW	13	22003051	missense	possibly damaging	0.74
R6440:Prss16	UTSW	13	22003160	missense	probably damaging	0.97
R6668:Prss16	UTSW	13	22006748	missense	probably null	0.01
R6791:Prss16	UTSW	13	22006067	missense	probably damaging	0.99
R7278:Prss16	UTSW	13	22003147	missense	probably damaging	1.00
R7924:Prss16	UTSW	13	22008664	missense	probably damaging	0.99
R8865:Prss16	UTSW	13	22003005	missense	possibly damaging	0.71
R8980:Prss16	UTSW	13	22003042	missense	probably benign	0.13
R9139:Prss16	UTSW	13	22008343	missense	probably damaging	1.00
R9211:Prss16	UTSW	13	22008584	missense	probably benign	0.19
R9276:Prss16	UTSW	13	22006005	start gained	probably benign
R9318:Prss16	UTSW	13	22006938	missense	possibly damaging	0.95
Z1176:Prss16	UTSW	13	22006054	nonsense	probably null
Z1176:Prss16	UTSW	13	22006400	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTACATGTTAAAACTGGCTGG -3'
(R):5'- AGTCCAGCCTAACACCGATG -3'

Sequencing Primer
(F):5'- TGGCGTCAAACTCACTATGCAG -3'
(R):5'- AACACCGATGCCTTCCTG -3'

Posted On

2014-10-15