Mutagenetix > Incidental Mutations

Incidental Mutation 'R2233:Cfap44'

240212

Institutional Source

Beutler Lab

Gene Symbol

Cfap44

Ensembl Gene

ENSMUSG00000071550

Gene Name

cilia and flagella associated protein 44

Synonyms

6330444M21Rik, D16Ertd642e, Wdr52

MMRRC Submission

040234-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2233 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44394796-44482428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44451525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1214 (I1214V)

Ref Sequence

ENSEMBL: ENSMUSP00000113908 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]

AlphaFold

E9Q5M6

Predicted Effect

probably benign
Transcript: ENSMUST00000099742
AA Change: I1214V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: I1214V

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120049
AA Change: I1214V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: I1214V

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	A	G	1: 63,545,512	I360V	probably benign	Het
Adarb1	A	G	10: 77,317,349	V322A	probably damaging	Het
Atad2b	T	G	12: 5,006,745	F867C	probably damaging	Het
Ccdc24	T	C	4: 117,869,916	K79R	possibly damaging	Het
Chrm4	A	G	2: 91,928,530	S428G	probably benign	Het
Chrnb1	A	T	11: 69,795,602	I64N	probably damaging	Het
Crh	A	T	3: 19,693,932	M182K	probably damaging	Het
Dazap1	A	G	10: 80,277,599	K110E	possibly damaging	Het
Dhx16	T	C	17: 35,887,886	C737R	probably damaging	Het
Dst	A	G	1: 34,274,262	E6384G	probably damaging	Het
Dync1i2	C	T	2: 71,249,420	Q419*	probably null	Het
E2f4	T	A	8: 105,298,651	V121E	probably damaging	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Fezf1	T	C	6: 23,246,003	T388A	probably damaging	Het
Gimap6	T	A	6: 48,704,484	H72L	possibly damaging	Het
Gm11149	A	G	9: 49,562,146		probably benign	Het
Gm12695	C	T	4: 96,724,029	R499Q	probably damaging	Het
Grhl1	A	G	12: 24,608,511	D385G	probably damaging	Het
Hyou1	C	T	9: 44,389,091	T855M	probably benign	Het
Igf1r	T	A	7: 68,212,080	N1129K	probably damaging	Het
Iglon5	T	C	7: 43,480,638	E34G	probably damaging	Het
Kcnab1	T	A	3: 65,319,467	V189D	probably damaging	Het
Kifap3	T	A	1: 163,856,065	D438E	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lrrc41	G	A	4: 116,096,385	R756Q	possibly damaging	Het
Lrrc49	A	T	9: 60,598,157	F538L	possibly damaging	Het
Nphp3	G	A	9: 104,037,376	R1052H	probably benign	Het
Nynrin	G	A	14: 55,872,067	V1544I	possibly damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1154	G	A	2: 87,903,475	S67F	probably damaging	Het
Olfr1346	T	C	7: 6,474,442	S111P	possibly damaging	Het
Osbpl6	T	C	2: 76,586,769	F577L	probably damaging	Het
Otc	A	G	X: 10,303,367	Q216R	probably benign	Het
Ppp1r12a	A	G	10: 108,198,919	I108M	possibly damaging	Het
Prl7a1	C	A	13: 27,642,419		probably null	Het
Prss16	T	C	13: 22,009,409	D72G	possibly damaging	Het
Qrsl1	T	C	10: 43,896,096	K33E	probably benign	Het
Rabepk	A	T	2: 34,795,234	I58N	possibly damaging	Het
Ralgapa1	A	T	12: 55,717,071	H1403Q	probably benign	Het
Rhobtb3	C	A	13: 75,872,365	C606F	possibly damaging	Het
Rnf216	G	A	5: 143,090,926	H68Y	probably benign	Het
Scap	T	C	9: 110,381,593	C998R	probably damaging	Het
Scgb1b27	T	C	7: 34,021,824	Y46H	probably damaging	Het
Sel1l2	T	C	2: 140,244,165	Y502C	probably damaging	Het
Sf3a2	G	T	10: 80,802,829	A95S	probably benign	Het
Sis	A	T	3: 72,913,194	F1412L	probably benign	Het
Slc25a29	A	T	12: 108,835,661	C9S	possibly damaging	Het
Snap91	T	C	9: 86,798,571	T427A	probably benign	Het
St3gal6	A	G	16: 58,473,534	F211L	probably damaging	Het
Stab1	G	A	14: 31,161,880	S240F	probably benign	Het
Sun3	T	A	11: 9,023,371	K109*	probably null	Het
Syne1	T	C	10: 5,041,484	N8410S	probably benign	Het
Tbx18	G	T	9: 87,724,350	S247R	probably damaging	Het
Tenm3	T	C	8: 48,276,169	I1601V	probably benign	Het
Tmem135	T	C	7: 89,154,074	N297S	probably damaging	Het
Tnk1	C	T	11: 69,855,191		probably null	Het
Txnl4b	A	G	8: 109,568,919		probably benign	Het
Uck1	T	C	2: 32,258,303	D167G	probably damaging	Het
Vmn2r124	A	T	17: 18,049,665	H61L	possibly damaging	Het
Xylt2	C	T	11: 94,669,996	V239M	possibly damaging	Het
Zmpste24	T	C	4: 121,097,965	D12G	probably benign	Het
Zscan25	A	G	5: 145,283,692	Y99C	probably damaging	Het

Other mutations in Cfap44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Cfap44	APN	16	44407404	missense	probably damaging	0.99
IGL00952:Cfap44	APN	16	44421275	missense	probably benign	0.33
IGL01340:Cfap44	APN	16	44404130	missense	probably damaging	1.00
IGL01530:Cfap44	APN	16	44449167	missense	probably damaging	1.00
IGL02083:Cfap44	APN	16	44437162	missense	probably damaging	1.00
IGL02088:Cfap44	APN	16	44451628	missense	possibly damaging	0.59
IGL02142:Cfap44	APN	16	44421144	missense	probably benign	0.15
IGL02311:Cfap44	APN	16	44404771	splice site	probably benign
IGL02574:Cfap44	APN	16	44481383	missense	probably damaging	1.00
IGL02893:Cfap44	APN	16	44416817	missense	probably damaging	1.00
IGL02959:Cfap44	APN	16	44470867	splice site	probably benign
IGL03291:Cfap44	APN	16	44407311	missense	possibly damaging	0.86
feldgrau	UTSW	16	44433666	nonsense	probably null
I2288:Cfap44	UTSW	16	44449138	nonsense	probably null
R0023:Cfap44	UTSW	16	44421220	missense	probably benign	0.01
R0023:Cfap44	UTSW	16	44421220	missense	probably benign	0.01
R0036:Cfap44	UTSW	16	44439069	missense	possibly damaging	0.83
R0139:Cfap44	UTSW	16	44433422	missense	possibly damaging	0.90
R0145:Cfap44	UTSW	16	44468372	missense	probably damaging	1.00
R0193:Cfap44	UTSW	16	44449210	splice site	probably null
R0238:Cfap44	UTSW	16	44422318	missense	probably benign
R0238:Cfap44	UTSW	16	44422318	missense	probably benign
R0288:Cfap44	UTSW	16	44415894	splice site	probably benign
R0367:Cfap44	UTSW	16	44433476	critical splice donor site	probably null
R0452:Cfap44	UTSW	16	44431945	missense	probably benign	0.01
R0531:Cfap44	UTSW	16	44401426	start codon destroyed	probably benign	0.01
R0722:Cfap44	UTSW	16	44404676	missense	possibly damaging	0.94
R0801:Cfap44	UTSW	16	44422486	missense	probably benign	0.41
R1209:Cfap44	UTSW	16	44422417	missense	possibly damaging	0.86
R1215:Cfap44	UTSW	16	44419303	missense	probably damaging	1.00
R1385:Cfap44	UTSW	16	44470775	missense	probably damaging	1.00
R1400:Cfap44	UTSW	16	44421212	missense	probably benign	0.01
R1415:Cfap44	UTSW	16	44481389	missense	probably damaging	0.99
R1475:Cfap44	UTSW	16	44433812	splice site	probably benign
R1901:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R1902:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R1903:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R2023:Cfap44	UTSW	16	44416012	missense	probably benign	0.01
R2126:Cfap44	UTSW	16	44410475	missense	probably benign	0.40
R2147:Cfap44	UTSW	16	44451684	missense	probably benign	0.31
R2439:Cfap44	UTSW	16	44481246	unclassified	probably benign
R3015:Cfap44	UTSW	16	44410469	missense	probably benign	0.40
R4178:Cfap44	UTSW	16	44451853	missense	possibly damaging	0.81
R4421:Cfap44	UTSW	16	44422437	missense	probably damaging	1.00
R4516:Cfap44	UTSW	16	44473864	nonsense	probably null
R4742:Cfap44	UTSW	16	44449252	splice site	probably null
R4766:Cfap44	UTSW	16	44415883	splice site	probably null
R4810:Cfap44	UTSW	16	44451535	missense	probably damaging	0.99
R4955:Cfap44	UTSW	16	44475277	missense	possibly damaging	0.75
R5058:Cfap44	UTSW	16	44420204	splice site	probably null
R5164:Cfap44	UTSW	16	44481389	missense	probably damaging	0.99
R5172:Cfap44	UTSW	16	44449193	missense	probably benign
R5344:Cfap44	UTSW	16	44416400	critical splice donor site	probably null
R5519:Cfap44	UTSW	16	44404088	missense	probably damaging	1.00
R5572:Cfap44	UTSW	16	44481305	missense	possibly damaging	0.95
R5601:Cfap44	UTSW	16	44460186	missense	probably damaging	1.00
R5625:Cfap44	UTSW	16	44460347	splice site	probably null
R5638:Cfap44	UTSW	16	44455531	missense	possibly damaging	0.94
R5727:Cfap44	UTSW	16	44435442	missense	probably damaging	0.98
R5950:Cfap44	UTSW	16	44479847	missense	probably damaging	0.99
R6057:Cfap44	UTSW	16	44449097	missense	probably benign	0.03
R6063:Cfap44	UTSW	16	44429892	missense	probably benign	0.00
R6221:Cfap44	UTSW	16	44437186	missense	probably benign	0.13
R6277:Cfap44	UTSW	16	44437306	missense	probably benign	0.04
R6322:Cfap44	UTSW	16	44433666	nonsense	probably null
R6836:Cfap44	UTSW	16	44404079	missense	probably damaging	0.99
R6854:Cfap44	UTSW	16	44449028	critical splice acceptor site	probably null
R6889:Cfap44	UTSW	16	44404132	missense	probably benign	0.03
R7233:Cfap44	UTSW	16	44422408	missense	probably damaging	0.99
R7294:Cfap44	UTSW	16	44404893	intron	probably benign
R7298:Cfap44	UTSW	16	44481412	missense	probably benign	0.04
R7332:Cfap44	UTSW	16	44429828	missense	probably damaging	1.00
R7410:Cfap44	UTSW	16	44468413	missense	probably damaging	1.00
R7455:Cfap44	UTSW	16	44404784	intron	probably benign
R7456:Cfap44	UTSW	16	44431942	missense	probably benign	0.07
R7491:Cfap44	UTSW	16	44470748	missense	probably damaging	1.00
R7587:Cfap44	UTSW	16	44404106	missense	probably benign	0.02
R7698:Cfap44	UTSW	16	44433786	missense	probably damaging	0.99
R7717:Cfap44	UTSW	16	44429935	missense	probably damaging	0.97
R7953:Cfap44	UTSW	16	44413691	missense	probably benign	0.00
R7994:Cfap44	UTSW	16	44432138	missense	probably damaging	0.97
R8043:Cfap44	UTSW	16	44413691	missense	probably benign	0.00
R8238:Cfap44	UTSW	16	44415305	splice site	probably null
R8338:Cfap44	UTSW	16	44419335	critical splice donor site	probably null
R8678:Cfap44	UTSW	16	44475273	missense	probably damaging	1.00
R8680:Cfap44	UTSW	16	44404722	missense	probably damaging	0.98
R8785:Cfap44	UTSW	16	44455532	missense	probably damaging	0.99
R8922:Cfap44	UTSW	16	44451667	missense	probably benign	0.23
R9005:Cfap44	UTSW	16	44460154	missense	probably damaging	1.00
R9020:Cfap44	UTSW	16	44437159	missense	probably damaging	0.99
R9110:Cfap44	UTSW	16	44435560	missense	probably damaging	0.98
R9111:Cfap44	UTSW	16	44431963	missense	probably benign	0.00
R9126:Cfap44	UTSW	16	44475256	missense	possibly damaging	0.77
R9194:Cfap44	UTSW	16	44468461	missense	probably damaging	1.00
R9251:Cfap44	UTSW	16	44408913	missense	probably damaging	0.99
R9334:Cfap44	UTSW	16	44419291	missense	probably damaging	0.98
R9336:Cfap44	UTSW	16	44422444	missense	probably damaging	0.97
V1662:Cfap44	UTSW	16	44449138	nonsense	probably null
X0060:Cfap44	UTSW	16	44449074	missense	possibly damaging	0.83
Z1088:Cfap44	UTSW	16	44401466	missense	probably damaging	0.98
Z1177:Cfap44	UTSW	16	44432044	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TCTCGCCAGTCCAAAGGTAG -3'
(R):5'- TTGAGGAACCCTACTAGCCC -3'

Sequencing Primer
(F):5'- CAGTCCAAAGGTAGAGGGTTAATAAC -3'
(R):5'- GAGCCCCCAGATCCTGTTC -3'

Posted On

2014-10-15