Incidental Mutation 'R2233:Dhx16'
ID 240215
Institutional Source Beutler Lab
Gene Symbol Dhx16
Ensembl Gene ENSMUSG00000024422
Gene Name DEAH (Asp-Glu-Ala-His) box polypeptide 16
Synonyms Ddx16, DBP2, 2410006N22Rik
MMRRC Submission 040234-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2233 (G1)
Quality Score 200
Status Not validated
Chromosome 17
Chromosomal Location 35879819-35892670 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35887886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 737 (C737R)
Ref Sequence ENSEMBL: ENSMUSP00000025292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025292] [ENSMUST00000146451] [ENSMUST00000148482] [ENSMUST00000148721] [ENSMUST00000174366]
AlphaFold G3X8X0
Predicted Effect probably damaging
Transcript: ENSMUST00000025292
AA Change: C737R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025292
Gene: ENSMUSG00000024422
AA Change: C737R

DomainStartEndE-ValueType
Blast:DEXDc 55 310 6e-57 BLAST
DEXDc 400 585 7.26e-33 SMART
HELICc 636 733 1.7e-15 SMART
HA2 794 885 2.24e-31 SMART
Pfam:OB_NTP_bind 901 1018 3.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059740
SMART Domains Protein: ENSMUSP00000050693
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
Pfam:DUF2358 75 200 5.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146451
SMART Domains Protein: ENSMUSP00000115771
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 191 1.5e-35 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148482
SMART Domains Protein: ENSMUSP00000114151
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:DUF2358 66 191 1.5e-35 PFAM
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148721
SMART Domains Protein: ENSMUSP00000116278
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
low complexity region 28 79 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF2358 149 274 1.4e-36 PFAM
low complexity region 289 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154670
SMART Domains Protein: ENSMUSP00000123547
Gene: ENSMUSG00000050705

DomainStartEndE-ValueType
Pfam:DUF2358 2 97 7.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173596
Predicted Effect probably benign
Transcript: ENSMUST00000173967
SMART Domains Protein: ENSMUSP00000133818
Gene: ENSMUSG00000024422

DomainStartEndE-ValueType
Blast:DEXDc 2 83 5e-35 BLAST
PDB:3I4U|A 4 83 6e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174330
Predicted Effect silent
Transcript: ENSMUST00000174366
SMART Domains Protein: ENSMUSP00000133888
Gene: ENSMUSG00000024422

DomainStartEndE-ValueType
Blast:DEXDc 55 310 9e-58 BLAST
DEXDc 400 585 7.26e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174449
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a functional homolog of fission yeast Prp8 protein involved in cell cycle progression. This gene is mapped to the MHC region on chromosome 6p21.3, a region where many malignant, genetic and autoimmune disease genes are linked. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A G 1: 63,545,512 I360V probably benign Het
Adarb1 A G 10: 77,317,349 V322A probably damaging Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Ccdc24 T C 4: 117,869,916 K79R possibly damaging Het
Cfap44 A G 16: 44,451,525 I1214V probably benign Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Chrnb1 A T 11: 69,795,602 I64N probably damaging Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Dazap1 A G 10: 80,277,599 K110E possibly damaging Het
Dst A G 1: 34,274,262 E6384G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fezf1 T C 6: 23,246,003 T388A probably damaging Het
Gimap6 T A 6: 48,704,484 H72L possibly damaging Het
Gm11149 A G 9: 49,562,146 probably benign Het
Gm12695 C T 4: 96,724,029 R499Q probably damaging Het
Grhl1 A G 12: 24,608,511 D385G probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Kifap3 T A 1: 163,856,065 D438E probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc41 G A 4: 116,096,385 R756Q possibly damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Nphp3 G A 9: 104,037,376 R1052H probably benign Het
Nynrin G A 14: 55,872,067 V1544I possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1154 G A 2: 87,903,475 S67F probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Ppp1r12a A G 10: 108,198,919 I108M possibly damaging Het
Prl7a1 C A 13: 27,642,419 probably null Het
Prss16 T C 13: 22,009,409 D72G possibly damaging Het
Qrsl1 T C 10: 43,896,096 K33E probably benign Het
Rabepk A T 2: 34,795,234 I58N possibly damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rhobtb3 C A 13: 75,872,365 C606F possibly damaging Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scap T C 9: 110,381,593 C998R probably damaging Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sf3a2 G T 10: 80,802,829 A95S probably benign Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc25a29 A T 12: 108,835,661 C9S possibly damaging Het
Snap91 T C 9: 86,798,571 T427A probably benign Het
St3gal6 A G 16: 58,473,534 F211L probably damaging Het
Stab1 G A 14: 31,161,880 S240F probably benign Het
Sun3 T A 11: 9,023,371 K109* probably null Het
Syne1 T C 10: 5,041,484 N8410S probably benign Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Tmem135 T C 7: 89,154,074 N297S probably damaging Het
Tnk1 C T 11: 69,855,191 probably null Het
Txnl4b A G 8: 109,568,919 probably benign Het
Uck1 T C 2: 32,258,303 D167G probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Xylt2 C T 11: 94,669,996 V239M possibly damaging Het
Zmpste24 T C 4: 121,097,965 D12G probably benign Het
Zscan25 A G 5: 145,283,692 Y99C probably damaging Het
Other mutations in Dhx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dhx16 APN 17 35887934 missense probably benign 0.02
IGL01533:Dhx16 APN 17 35882047 missense probably damaging 1.00
IGL01743:Dhx16 APN 17 35888108 missense probably damaging 1.00
IGL01946:Dhx16 APN 17 35885504 missense probably benign 0.01
IGL02170:Dhx16 APN 17 35889469 missense probably damaging 1.00
IGL02327:Dhx16 APN 17 35883825 missense probably benign 0.00
IGL02334:Dhx16 APN 17 35884057 missense probably damaging 1.00
IGL02417:Dhx16 APN 17 35892537 missense probably damaging 1.00
R0403:Dhx16 UTSW 17 35883050 critical splice donor site probably null
R0410:Dhx16 UTSW 17 35890967 missense probably damaging 1.00
R0544:Dhx16 UTSW 17 35881659 missense probably benign 0.35
R0835:Dhx16 UTSW 17 35881689 missense probably damaging 1.00
R0845:Dhx16 UTSW 17 35883302 missense probably damaging 1.00
R1642:Dhx16 UTSW 17 35891065 missense probably damaging 1.00
R1833:Dhx16 UTSW 17 35885619 missense probably benign 0.36
R1905:Dhx16 UTSW 17 35888355 missense probably benign
R2234:Dhx16 UTSW 17 35887886 missense probably damaging 1.00
R4647:Dhx16 UTSW 17 35885635 missense probably benign 0.10
R4648:Dhx16 UTSW 17 35885635 missense probably benign 0.10
R4665:Dhx16 UTSW 17 35879943 missense probably damaging 1.00
R4674:Dhx16 UTSW 17 35885939 missense probably damaging 1.00
R4862:Dhx16 UTSW 17 35883262 missense probably benign 0.34
R5089:Dhx16 UTSW 17 35884089 missense probably damaging 1.00
R5122:Dhx16 UTSW 17 35883310 missense probably damaging 1.00
R5665:Dhx16 UTSW 17 35891086 nonsense probably null
R5748:Dhx16 UTSW 17 35883314 missense probably damaging 1.00
R5763:Dhx16 UTSW 17 35881688 missense possibly damaging 0.87
R5956:Dhx16 UTSW 17 35882870 missense probably damaging 0.96
R6001:Dhx16 UTSW 17 35883874 missense probably damaging 1.00
R6216:Dhx16 UTSW 17 35882972 missense possibly damaging 0.49
R6420:Dhx16 UTSW 17 35883014 missense possibly damaging 0.92
R6467:Dhx16 UTSW 17 35886184 missense probably damaging 1.00
R7326:Dhx16 UTSW 17 35886160 missense probably damaging 1.00
R7338:Dhx16 UTSW 17 35888144 missense probably damaging 1.00
R7457:Dhx16 UTSW 17 35891060 missense probably damaging 1.00
R7736:Dhx16 UTSW 17 35881676 missense possibly damaging 0.79
R8508:Dhx16 UTSW 17 35885920 missense probably damaging 1.00
R8552:Dhx16 UTSW 17 35881291 missense possibly damaging 0.83
R8733:Dhx16 UTSW 17 35881375 missense probably benign 0.13
R8831:Dhx16 UTSW 17 35888108 missense probably damaging 1.00
R9014:Dhx16 UTSW 17 35882598 missense probably benign 0.00
R9194:Dhx16 UTSW 17 35889281 missense probably benign 0.01
R9350:Dhx16 UTSW 17 35889311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGATGGGGATTATCACTTACC -3'
(R):5'- ATCAGGTCATGGATCCCTGG -3'

Sequencing Primer
(F):5'- TTCTGAGTTAACACTGACCAGGCG -3'
(R):5'- TCCCTGGGGAAAGGAATAAAGAATG -3'
Posted On 2014-10-15