Incidental Mutation 'R2238:Clca3a1'
ID 240221
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Name chloride channel accessory 3A1
Synonyms Clca1
MMRRC Submission 040238-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R2238 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144435438-144466738 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144457766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 373 (I373F)
Ref Sequence ENSEMBL: ENSMUSP00000054526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
AlphaFold Q9QX15
Predicted Effect possibly damaging
Transcript: ENSMUST00000029932
AA Change: I373F

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025
AA Change: I373F

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059091
AA Change: I373F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: I373F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196146
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm1 T A 4: 144,246,469 (GRCm39) V5E possibly damaging Het
Acaca T C 11: 84,282,331 (GRCm39) probably benign Het
Adam18 T C 8: 25,136,303 (GRCm39) E406G probably benign Het
Adgrl4 A T 3: 151,205,779 (GRCm39) I164F probably damaging Het
Arhgap36 G T X: 48,582,282 (GRCm39) V60L possibly damaging Het
Bmi1 T C 2: 18,688,225 (GRCm39) probably benign Het
Carf T C 1: 60,187,193 (GRCm39) S599P probably benign Het
Cdc37 G A 9: 21,053,829 (GRCm39) Q176* probably null Het
Clnk A G 5: 38,921,694 (GRCm39) probably benign Het
Cnot1 T C 8: 96,496,149 (GRCm39) I342V probably benign Het
Dact2 A T 17: 14,417,312 (GRCm39) L296Q probably damaging Het
Dctn2 C T 10: 127,112,257 (GRCm39) T123I probably damaging Het
Deup1 A C 9: 15,486,597 (GRCm39) I455S probably damaging Het
Dnmbp A G 19: 43,857,303 (GRCm39) V957A possibly damaging Het
Emilin2 T C 17: 71,581,734 (GRCm39) R331G possibly damaging Het
Eomes A G 9: 118,311,359 (GRCm39) D394G probably damaging Het
Epn1 A G 7: 5,100,601 (GRCm39) N518S probably damaging Het
Gbf1 T C 19: 46,152,057 (GRCm39) I30T probably benign Het
Gcc1 A G 6: 28,420,462 (GRCm39) V285A probably benign Het
Gopc T C 10: 52,229,499 (GRCm39) H188R probably damaging Het
Herc6 A G 6: 57,631,386 (GRCm39) N693D probably benign Het
Hipk2 A G 6: 38,706,850 (GRCm39) probably benign Het
Htatsf1 G T X: 56,111,864 (GRCm39) D642Y unknown Het
Ints1 G A 5: 139,750,955 (GRCm39) T814M possibly damaging Het
Kdm6a T C X: 18,065,476 (GRCm39) F104S probably damaging Het
Kdr T A 5: 76,110,179 (GRCm39) Y936F possibly damaging Het
Ly6k T C 15: 74,669,018 (GRCm39) E87G probably benign Het
Lyst A G 13: 13,917,848 (GRCm39) N3303D probably benign Het
Mindy4 T C 6: 55,278,055 (GRCm39) F633S probably damaging Het
Msl2 T A 9: 100,978,569 (GRCm39) N314K probably benign Het
Ncapd3 A G 9: 26,978,320 (GRCm39) T840A probably benign Het
Neil3 T C 8: 54,052,311 (GRCm39) D429G possibly damaging Het
Nt5c1b C A 12: 10,425,558 (GRCm39) T309K probably damaging Het
Nt5c1b A G 12: 10,440,108 (GRCm39) Y550C probably damaging Het
Or10v5 T C 19: 11,805,814 (GRCm39) D192G probably damaging Het
Pabpc4l A C 3: 46,401,137 (GRCm39) V169G probably damaging Het
Pcgf5 A T 19: 36,414,754 (GRCm39) N105I probably damaging Het
Phka2 A G X: 159,324,408 (GRCm39) E254G probably damaging Het
Pik3cb A G 9: 98,923,081 (GRCm39) Y984H probably damaging Het
Ptprz1 A T 6: 22,987,376 (GRCm39) Q387L probably damaging Het
Rassf8 T C 6: 145,762,910 (GRCm39) V419A probably damaging Het
Rnf148 T C 6: 23,654,345 (GRCm39) Y217C probably benign Het
Sec24d T A 3: 123,143,543 (GRCm39) probably null Het
Sesn3 T C 9: 14,219,761 (GRCm39) V50A probably benign Het
Sgcd T C 11: 47,023,509 (GRCm39) N99D possibly damaging Het
Sncaip T C 18: 53,001,619 (GRCm39) S47P probably damaging Het
Sp2 C T 11: 96,846,762 (GRCm39) C527Y probably damaging Het
Spata4 A C 8: 55,055,664 (GRCm39) K185T probably benign Het
Spin2c A G X: 152,616,672 (GRCm39) I162V probably damaging Het
Srcin1 T C 11: 97,425,645 (GRCm39) T471A probably benign Het
Stac G A 9: 111,519,190 (GRCm39) probably benign Het
Tcaf3 A G 6: 42,570,262 (GRCm39) Y497H probably benign Het
Tmem40 C T 6: 115,708,038 (GRCm39) W150* probably null Het
Tmem59l T C 8: 70,937,772 (GRCm39) T203A probably damaging Het
Tnfsf11 A T 14: 78,537,421 (GRCm39) S81T possibly damaging Het
Topaz1 C T 9: 122,600,212 (GRCm39) T984I probably benign Het
Vmn1r204 A G 13: 22,740,993 (GRCm39) H208R probably benign Het
Vmn2r98 T A 17: 19,286,213 (GRCm39) M237K probably damaging Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca3a1 APN 3 144,733,660 (GRCm39) missense probably benign 0.01
IGL00768:Clca3a1 APN 3 144,461,012 (GRCm39) missense probably damaging 0.96
IGL00862:Clca3a1 APN 3 144,730,332 (GRCm39) missense possibly damaging 0.89
IGL00895:Clca3a1 APN 3 144,730,357 (GRCm39) missense probably damaging 1.00
IGL00969:Clca3a1 APN 3 144,714,719 (GRCm39) missense possibly damaging 0.80
IGL01331:Clca3a1 APN 3 144,453,273 (GRCm39) missense probably damaging 1.00
IGL01398:Clca3a1 APN 3 144,722,512 (GRCm39) missense possibly damaging 0.81
IGL01447:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01455:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01457:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01458:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01462:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01473:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01488:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01490:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01632:Clca3a1 APN 3 144,733,202 (GRCm39) missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144,453,333 (GRCm39) nonsense probably null
IGL01896:Clca3a1 APN 3 144,721,438 (GRCm39) missense possibly damaging 0.79
IGL01940:Clca3a1 APN 3 144,452,737 (GRCm39) missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144,460,564 (GRCm39) missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144,457,690 (GRCm39) splice site probably benign
IGL02411:Clca3a1 APN 3 144,733,763 (GRCm39) missense possibly damaging 0.89
IGL03093:Clca3a1 APN 3 144,453,262 (GRCm39) missense probably damaging 0.99
IGL03156:Clca3a1 APN 3 144,719,672 (GRCm39) missense probably damaging 1.00
Lucha UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144,436,640 (GRCm39) missense probably damaging 0.98
R0472:Clca3a1 UTSW 3 144,733,106 (GRCm39) missense probably damaging 1.00
R0513:Clca3a1 UTSW 3 144,466,323 (GRCm39) critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144,454,155 (GRCm39) splice site probably benign
R0571:Clca3a1 UTSW 3 144,713,550 (GRCm39) missense probably damaging 1.00
R0585:Clca3a1 UTSW 3 144,738,386 (GRCm39) missense probably benign 0.16
R0586:Clca3a1 UTSW 3 144,738,350 (GRCm39) missense probably benign 0.45
R0791:Clca3a1 UTSW 3 144,710,615 (GRCm39) missense probably benign 0.01
R1187:Clca3a1 UTSW 3 144,715,504 (GRCm39) missense probably benign 0.30
R1522:Clca3a1 UTSW 3 144,460,932 (GRCm39) missense probably benign 0.01
R1713:Clca3a1 UTSW 3 144,730,307 (GRCm39) missense probably benign 0.00
R1739:Clca3a1 UTSW 3 144,713,539 (GRCm39) missense probably benign 0.00
R1744:Clca3a1 UTSW 3 144,452,596 (GRCm39) missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144,452,590 (GRCm39) missense probably damaging 0.99
R2079:Clca3a1 UTSW 3 144,713,534 (GRCm39) missense possibly damaging 0.80
R2129:Clca3a1 UTSW 3 144,722,526 (GRCm39) missense probably damaging 1.00
R2178:Clca3a1 UTSW 3 144,711,863 (GRCm39) missense probably damaging 1.00
R2234:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2235:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2240:Clca3a1 UTSW 3 144,714,746 (GRCm39) missense probably damaging 1.00
R2278:Clca3a1 UTSW 3 144,463,785 (GRCm39) missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144,443,619 (GRCm39) splice site probably null
R3737:Clca3a1 UTSW 3 144,436,482 (GRCm39) missense probably benign 0.01
R3751:Clca3a1 UTSW 3 144,724,424 (GRCm39) missense probably benign 0.01
R3974:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3975:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3981:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144,460,994 (GRCm39) missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144,466,483 (GRCm39) start codon destroyed probably benign 0.08
R4409:Clca3a1 UTSW 3 144,711,788 (GRCm39) missense probably damaging 1.00
R4543:Clca3a1 UTSW 3 144,452,749 (GRCm39) missense probably damaging 1.00
R4586:Clca3a1 UTSW 3 144,722,619 (GRCm39) missense probably damaging 1.00
R4751:Clca3a1 UTSW 3 144,710,609 (GRCm39) missense possibly damaging 0.89
R4766:Clca3a1 UTSW 3 144,455,473 (GRCm39) missense probably damaging 1.00
R4894:Clca3a1 UTSW 3 144,719,662 (GRCm39) missense probably damaging 0.99
R4899:Clca3a1 UTSW 3 144,443,722 (GRCm39) missense probably damaging 1.00
R4909:Clca3a1 UTSW 3 144,730,324 (GRCm39) missense probably damaging 1.00
R4916:Clca3a1 UTSW 3 144,721,605 (GRCm39) missense probably benign 0.01
R4941:Clca3a1 UTSW 3 144,721,414 (GRCm39) missense probably damaging 1.00
R4942:Clca3a1 UTSW 3 144,710,524 (GRCm39) missense probably benign 0.02
R5044:Clca3a1 UTSW 3 144,713,689 (GRCm39) splice site probably null
R5090:Clca3a1 UTSW 3 144,443,633 (GRCm39) missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144,436,483 (GRCm39) missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144,452,545 (GRCm39) missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144,442,897 (GRCm39) missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144,442,766 (GRCm39) missense possibly damaging 0.77
R5451:Clca3a1 UTSW 3 144,733,747 (GRCm39) missense probably damaging 1.00
R5618:Clca3a1 UTSW 3 144,710,738 (GRCm39) missense probably benign 0.00
R5724:Clca3a1 UTSW 3 144,714,833 (GRCm39) missense probably benign 0.01
R5871:Clca3a1 UTSW 3 144,460,642 (GRCm39) missense probably damaging 1.00
R5898:Clca3a1 UTSW 3 144,722,522 (GRCm39) missense possibly damaging 0.89
R5907:Clca3a1 UTSW 3 144,455,403 (GRCm39) intron probably benign
R5976:Clca3a1 UTSW 3 144,452,636 (GRCm39) missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144,463,821 (GRCm39) missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144,464,993 (GRCm39) missense possibly damaging 0.65
R6238:Clca3a1 UTSW 3 144,714,716 (GRCm39) missense probably benign 0.09
R6263:Clca3a1 UTSW 3 144,455,539 (GRCm39) missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144,464,275 (GRCm39) missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144,436,558 (GRCm39) missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144,465,020 (GRCm39) missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144,465,021 (GRCm39) missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144,442,708 (GRCm39) missense probably damaging 1.00
R6590:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6591:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6592:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6690:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6691:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6729:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R6805:Clca3a1 UTSW 3 144,724,428 (GRCm39) missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144,453,329 (GRCm39) missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144,460,967 (GRCm39) missense probably damaging 0.97
R7106:Clca3a1 UTSW 3 144,733,190 (GRCm39) missense probably damaging 0.98
R7121:Clca3a1 UTSW 3 144,717,567 (GRCm39) missense probably damaging 1.00
R7127:Clca3a1 UTSW 3 144,711,806 (GRCm39) missense probably damaging 1.00
R7139:Clca3a1 UTSW 3 144,461,063 (GRCm39) missense possibly damaging 0.58
R7212:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R7444:Clca3a1 UTSW 3 144,733,193 (GRCm39) missense probably damaging 1.00
R7446:Clca3a1 UTSW 3 144,733,188 (GRCm39) missense possibly damaging 0.65
R7535:Clca3a1 UTSW 3 144,724,328 (GRCm39) missense probably damaging 0.99
R7638:Clca3a1 UTSW 3 144,457,723 (GRCm39) missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144,442,797 (GRCm39) missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144,455,492 (GRCm39) missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144,463,723 (GRCm39) missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144,436,579 (GRCm39) missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144,455,446 (GRCm39) missense probably damaging 1.00
R8305:Clca3a1 UTSW 3 144,464,927 (GRCm39) splice site probably benign
R8416:Clca3a1 UTSW 3 144,460,914 (GRCm39) critical splice donor site probably null
R8437:Clca3a1 UTSW 3 144,710,822 (GRCm39) missense probably benign 0.00
R8446:Clca3a1 UTSW 3 144,454,248 (GRCm39) missense probably damaging 0.97
R8474:Clca3a1 UTSW 3 144,710,792 (GRCm39) missense possibly damaging 0.77
R8496:Clca3a1 UTSW 3 144,453,182 (GRCm39) makesense probably null
R8766:Clca3a1 UTSW 3 144,714,939 (GRCm39) splice site probably benign
R8884:Clca3a1 UTSW 3 144,719,757 (GRCm39) missense probably benign 0.35
R9014:Clca3a1 UTSW 3 144,442,731 (GRCm39) missense probably benign 0.01
R9049:Clca3a1 UTSW 3 144,733,143 (GRCm39) missense probably benign 0.01
R9128:Clca3a1 UTSW 3 144,463,795 (GRCm39) missense probably damaging 1.00
R9306:Clca3a1 UTSW 3 144,730,339 (GRCm39) missense probably damaging 1.00
R9601:Clca3a1 UTSW 3 144,453,310 (GRCm39) missense probably benign 0.27
R9623:Clca3a1 UTSW 3 144,719,698 (GRCm39) missense probably benign 0.03
X0020:Clca3a1 UTSW 3 144,738,421 (GRCm39) missense possibly damaging 0.89
Z1088:Clca3a1 UTSW 3 144,452,714 (GRCm39) missense probably damaging 1.00
Z1176:Clca3a1 UTSW 3 144,719,682 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGTGAAGCTACTTTCAGAAAGG -3'
(R):5'- AGACCCTGCTATTGTACATGC -3'

Sequencing Primer
(F):5'- AAAGGTTTTTCTCTTTCAGGTCAG -3'
(R):5'- GCATCTTTCTCTTACAGGAAGACCG -3'
Posted On 2014-10-15