Incidental Mutation 'R0164:Ufl1'
ID 24023
Institutional Source Beutler Lab
Gene Symbol Ufl1
Ensembl Gene ENSMUSG00000040359
Gene Name UFM1 specific ligase 1
Synonyms 1810074P20Rik, Maxer, Rcad
MMRRC Submission 038440-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R0164 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 4
Chromosomal Location 25248600-25281821 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25256008 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 504 (Y504N)
Ref Sequence ENSEMBL: ENSMUSP00000100059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038705] [ENSMUST00000102994]
AlphaFold Q8CCJ3
Predicted Effect probably benign
Transcript: ENSMUST00000038705
AA Change: Y424N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042118
Gene: ENSMUSG00000040359
AA Change: Y424N

DomainStartEndE-ValueType
Pfam:DUF2042 2 205 1.5e-70 PFAM
low complexity region 334 344 N/A INTRINSIC
low complexity region 348 358 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102994
AA Change: Y504N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100059
Gene: ENSMUSG00000040359
AA Change: Y504N

DomainStartEndE-ValueType
Pfam:DUF2042 7 284 4.8e-117 PFAM
low complexity region 414 424 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 444 454 N/A INTRINSIC
low complexity region 455 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142949
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogensis, anemia and decreased erythroid progenitor cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 (GRCm38) probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 (GRCm38) probably null Het
4930522L14Rik T C 5: 109,736,847 (GRCm38) K382E probably damaging Het
Adck1 A G 12: 88,455,510 (GRCm38) E297G probably damaging Het
Ahrr G A 13: 74,283,024 (GRCm38) probably benign Het
Aldh3a2 C T 11: 61,248,888 (GRCm38) V473I probably benign Het
Arfgef3 A T 10: 18,647,915 (GRCm38) I369K possibly damaging Het
Atl2 A G 17: 79,853,831 (GRCm38) probably benign Het
Atp1b3 T C 9: 96,338,709 (GRCm38) I178V possibly damaging Het
Axdnd1 T C 1: 156,378,386 (GRCm38) E520G possibly damaging Het
Bahcc1 A T 11: 120,285,074 (GRCm38) probably benign Het
BB019430 A T 10: 58,704,271 (GRCm38) noncoding transcript Het
BC028528 A T 3: 95,887,334 (GRCm38) probably benign Het
Btbd1 T A 7: 81,801,003 (GRCm38) Q343L probably benign Het
Catsper1 A G 19: 5,339,475 (GRCm38) T473A possibly damaging Het
Ccn4 T C 15: 66,919,210 (GRCm38) L287P probably damaging Het
Chmp6 G A 11: 119,915,523 (GRCm38) probably null Het
Cstdc7 T A 18: 42,173,543 (GRCm38) D58E probably damaging Het
D130040H23Rik T C 8: 69,302,543 (GRCm38) V200A possibly damaging Het
D830013O20Rik C T 12: 73,364,331 (GRCm38) noncoding transcript Het
Dcaf1 T A 9: 106,844,145 (GRCm38) S379T possibly damaging Het
Dcaf4 G A 12: 83,535,988 (GRCm38) probably benign Het
Dhx58 T C 11: 100,695,324 (GRCm38) I624V probably benign Het
Disp3 T C 4: 148,254,251 (GRCm38) E821G probably damaging Het
Dlc1 T A 8: 36,599,440 (GRCm38) E464V probably damaging Het
Dnah10 G A 5: 124,783,834 (GRCm38) V2151I probably damaging Het
Dnah6 C T 6: 73,188,535 (GRCm38) probably benign Het
Dnah8 G A 17: 30,748,665 (GRCm38) G2617D probably benign Het
Dnah9 C A 11: 65,918,804 (GRCm38) E872* probably null Het
Dock9 T C 14: 121,597,665 (GRCm38) Y99C probably damaging Het
Dpy19l3 T A 7: 35,716,646 (GRCm38) I310F probably damaging Het
Fggy A T 4: 95,837,654 (GRCm38) I137F probably damaging Het
Gli2 A G 1: 118,890,283 (GRCm38) probably benign Het
Gm14421 A T 2: 177,056,722 (GRCm38) noncoding transcript Het
Grin2a A G 16: 9,994,821 (GRCm38) probably null Het
Grin2b A G 6: 135,778,648 (GRCm38) probably benign Het
Incenp A G 19: 9,894,879 (GRCm38) S72P probably benign Het
Ipo11 A G 13: 106,910,194 (GRCm38) probably benign Het
Klc3 T A 7: 19,394,926 (GRCm38) N469Y possibly damaging Het
Lrrc42 A G 4: 107,247,505 (GRCm38) S88P probably benign Het
Lrrc49 G A 9: 60,680,600 (GRCm38) T93I probably benign Het
Ltn1 G A 16: 87,405,519 (GRCm38) probably benign Het
Mlycd A T 8: 119,407,641 (GRCm38) Q294L probably damaging Het
Mmrn1 T A 6: 60,975,815 (GRCm38) probably benign Het
Mrpl22 T A 11: 58,171,821 (GRCm38) I19N probably benign Het
Msh3 T A 13: 92,349,209 (GRCm38) K202N probably damaging Het
N4bp2 T C 5: 65,803,573 (GRCm38) probably benign Het
Ncam1 C T 9: 49,568,409 (GRCm38) D90N probably damaging Het
Nckap5 A T 1: 126,024,407 (GRCm38) D1405E possibly damaging Het
Ncoa2 A G 1: 13,186,731 (GRCm38) probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 (GRCm38) probably null Het
Nlrp1b A T 11: 71,164,099 (GRCm38) W844R probably damaging Het
Nmnat1 G T 4: 149,469,150 (GRCm38) N168K possibly damaging Het
Or5b96 A G 19: 12,890,445 (GRCm38) L44P probably damaging Het
Ost4 T C 5: 30,907,459 (GRCm38) H26R probably damaging Het
Otog G A 7: 46,304,231 (GRCm38) V2638M probably damaging Het
Otogl A T 10: 107,874,530 (GRCm38) I566N probably damaging Het
Pcyt1a T C 16: 32,470,186 (GRCm38) S282P probably damaging Het
Prkcg G A 7: 3,329,119 (GRCm38) E581K probably damaging Het
Ralgps2 A G 1: 156,887,089 (GRCm38) probably null Het
Rnf157 A G 11: 116,354,810 (GRCm38) probably benign Het
Scmh1 T C 4: 120,529,865 (GRCm38) probably benign Het
Sgo2b T C 8: 63,938,383 (GRCm38) H150R possibly damaging Het
Sh2b3 T G 5: 121,829,037 (GRCm38) T5P probably damaging Het
Skint6 A T 4: 112,991,236 (GRCm38) probably benign Het
Slfn10-ps T C 11: 83,035,302 (GRCm38) noncoding transcript Het
Sspo T A 6: 48,494,194 (GRCm38) probably benign Het
Tcp1 T A 17: 12,922,747 (GRCm38) probably benign Het
Tdp2 A G 13: 24,838,239 (GRCm38) M214V probably damaging Het
Tenm4 T G 7: 96,729,340 (GRCm38) probably benign Het
Tmem144 G A 3: 79,839,273 (GRCm38) probably benign Het
Tmem204 A G 17: 25,058,350 (GRCm38) I187T probably damaging Het
Tmem208 T G 8: 105,334,694 (GRCm38) D117E probably benign Het
Tnks1bp1 C T 2: 85,059,221 (GRCm38) P631S possibly damaging Het
Tomm70a T C 16: 57,147,821 (GRCm38) V517A probably damaging Het
Ttc7 T C 17: 87,379,895 (GRCm38) V801A probably damaging Het
Txndc5 A T 13: 38,507,953 (GRCm38) C146S probably damaging Het
Ubac2 A G 14: 122,008,917 (GRCm38) probably benign Het
Ube4b G T 4: 149,360,324 (GRCm38) T493K probably damaging Het
Ugt1a6a T C 1: 88,139,270 (GRCm38) V266A possibly damaging Het
Ugt1a6b T A 1: 88,107,467 (GRCm38) C176S probably damaging Het
Ulk3 T A 9: 57,590,686 (GRCm38) I90N probably damaging Het
Unc13c T C 9: 73,694,892 (GRCm38) I1357M probably benign Het
Vmn1r28 G A 6: 58,265,717 (GRCm38) A182T probably benign Het
Vmn2r114 A G 17: 23,309,826 (GRCm38) probably null Het
Vmn2r91 A C 17: 18,106,137 (GRCm38) N228T probably benign Het
Wdr43 T G 17: 71,631,997 (GRCm38) probably benign Het
Zbtb6 G T 2: 37,429,588 (GRCm38) Y109* probably null Het
Zfp980 A G 4: 145,701,997 (GRCm38) D432G probably benign Het
Other mutations in Ufl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ufl1 APN 4 25,280,631 (GRCm38) missense possibly damaging 0.67
IGL00899:Ufl1 APN 4 25,262,238 (GRCm38) missense probably damaging 1.00
IGL00928:Ufl1 APN 4 25,267,790 (GRCm38) missense probably damaging 1.00
IGL00949:Ufl1 APN 4 25,275,822 (GRCm38) missense probably damaging 0.99
IGL02179:Ufl1 APN 4 25,254,896 (GRCm38) missense probably damaging 0.99
IGL02228:Ufl1 APN 4 25,281,686 (GRCm38) missense probably benign
IGL02237:Ufl1 APN 4 25,269,082 (GRCm38) missense probably benign 0.01
IGL02294:Ufl1 APN 4 25,259,281 (GRCm38) nonsense probably null
IGL02331:Ufl1 APN 4 25,251,971 (GRCm38) missense probably damaging 1.00
IGL02374:Ufl1 APN 4 25,259,237 (GRCm38) missense probably benign 0.01
IGL02541:Ufl1 APN 4 25,250,534 (GRCm38) missense possibly damaging 0.56
IGL03053:Ufl1 APN 4 25,275,833 (GRCm38) missense probably damaging 0.99
R0054:Ufl1 UTSW 4 25,269,087 (GRCm38) missense probably damaging 0.96
R0054:Ufl1 UTSW 4 25,269,087 (GRCm38) missense probably damaging 0.96
R0164:Ufl1 UTSW 4 25,256,008 (GRCm38) missense probably benign 0.00
R0172:Ufl1 UTSW 4 25,280,685 (GRCm38) missense probably benign 0.32
R2069:Ufl1 UTSW 4 25,269,036 (GRCm38) missense possibly damaging 0.75
R4320:Ufl1 UTSW 4 25,278,601 (GRCm38) splice site probably null
R4467:Ufl1 UTSW 4 25,254,806 (GRCm38) missense probably damaging 1.00
R4993:Ufl1 UTSW 4 25,267,832 (GRCm38) missense possibly damaging 0.70
R5049:Ufl1 UTSW 4 25,254,773 (GRCm38) missense probably benign 0.17
R5071:Ufl1 UTSW 4 25,254,780 (GRCm38) missense probably benign
R5072:Ufl1 UTSW 4 25,254,780 (GRCm38) missense probably benign
R5073:Ufl1 UTSW 4 25,254,780 (GRCm38) missense probably benign
R5099:Ufl1 UTSW 4 25,275,914 (GRCm38) missense probably damaging 0.99
R5108:Ufl1 UTSW 4 25,269,026 (GRCm38) critical splice donor site probably null
R5127:Ufl1 UTSW 4 25,256,010 (GRCm38) missense probably benign 0.05
R5262:Ufl1 UTSW 4 25,251,294 (GRCm38) intron probably benign
R5409:Ufl1 UTSW 4 25,280,706 (GRCm38) missense probably damaging 1.00
R5942:Ufl1 UTSW 4 25,250,619 (GRCm38) missense probably benign
R6031:Ufl1 UTSW 4 25,278,038 (GRCm38) missense probably benign 0.09
R6031:Ufl1 UTSW 4 25,278,038 (GRCm38) missense probably benign 0.09
R6107:Ufl1 UTSW 4 25,251,999 (GRCm38) missense possibly damaging 0.88
R6157:Ufl1 UTSW 4 25,279,350 (GRCm38) missense possibly damaging 0.83
R6296:Ufl1 UTSW 4 25,270,572 (GRCm38) missense probably benign
R6360:Ufl1 UTSW 4 25,265,476 (GRCm38) missense probably benign
R6514:Ufl1 UTSW 4 25,262,238 (GRCm38) missense probably damaging 1.00
R6754:Ufl1 UTSW 4 25,267,796 (GRCm38) nonsense probably null
R6755:Ufl1 UTSW 4 25,262,316 (GRCm38) missense probably damaging 0.96
R7196:Ufl1 UTSW 4 25,250,669 (GRCm38) missense probably benign 0.05
R7247:Ufl1 UTSW 4 25,254,637 (GRCm38) missense probably damaging 1.00
R7287:Ufl1 UTSW 4 25,254,852 (GRCm38) missense probably benign 0.04
R7755:Ufl1 UTSW 4 25,262,274 (GRCm38) missense probably benign
R8156:Ufl1 UTSW 4 25,269,057 (GRCm38) missense probably damaging 1.00
R8235:Ufl1 UTSW 4 25,278,656 (GRCm38) missense probably benign 0.31
R8247:Ufl1 UTSW 4 25,250,606 (GRCm38) missense probably benign
R8933:Ufl1 UTSW 4 25,262,258 (GRCm38) missense possibly damaging 0.62
R9008:Ufl1 UTSW 4 25,254,778 (GRCm38) nonsense probably null
R9147:Ufl1 UTSW 4 25,278,712 (GRCm38) splice site probably benign
R9197:Ufl1 UTSW 4 25,250,519 (GRCm38) missense possibly damaging 0.50
R9404:Ufl1 UTSW 4 25,275,912 (GRCm38) missense probably benign 0.00
R9601:Ufl1 UTSW 4 25,275,807 (GRCm38) missense probably benign 0.22
RF037:Ufl1 UTSW 4 25,280,628 (GRCm38) missense possibly damaging 0.67
RF039:Ufl1 UTSW 4 25,280,628 (GRCm38) missense possibly damaging 0.67
V7732:Ufl1 UTSW 4 25,251,368 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTTTGAGGTCAGTTGTACCCCTCC -3'
(R):5'- CCTGGTGAGGTATGCATTCTCTGC -3'

Sequencing Primer
(F):5'- ACGTCAGTGAGCACTTCAG -3'
(R):5'- GTATGCATTCTCTGCCTGGTC -3'
Posted On 2013-04-16