Mutagenetix > Incidental Mutations

Incidental Mutation 'R2238:Rassf8'

240235

Institutional Source

Beutler Lab

Gene Symbol

Rassf8

Ensembl Gene

ENSMUSG00000030259

Gene Name

Ras association (RalGDS/AF-6) domain family (N-terminal) member 8

Synonyms

5133400D11Rik, mHoj-1

MMRRC Submission

040238-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.774) question?

Stock #

R2238 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145746748-145821079 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 145817184 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 419 (V419A)

Ref Sequence

ENSEMBL: ENSMUSP00000107333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032388
AA Change: V419A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: V419A

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058538

Predicted Effect

probably damaging
Transcript: ENSMUST00000111704
AA Change: V419A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: V419A

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140966

SMART Domains

Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	80	7.85e-7	SMART

Meta Mutation Damage Score

0.1532

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430007A20Rik	T	A	4: 144,519,899	V5E	possibly damaging	Het
Acaca	T	C	11: 84,391,505		probably benign	Het
Adam18	T	C	8: 24,646,287	E406G	probably benign	Het
Adgrl4	A	T	3: 151,500,142	I164F	probably damaging	Het
Arhgap36	G	T	X: 49,493,405	V60L	possibly damaging	Het
Bmi1	T	C	2: 18,683,414		probably benign	Het
Carf	T	C	1: 60,148,034	S599P	probably benign	Het
Cdc37	G	A	9: 21,142,533	Q176*	probably null	Het
Clca3a1	T	A	3: 144,752,005	I373F	possibly damaging	Het
Clnk	A	G	5: 38,764,351		probably benign	Het
Cnot1	T	C	8: 95,769,521	I342V	probably benign	Het
Dact2	A	T	17: 14,197,050	L296Q	probably damaging	Het
Dctn2	C	T	10: 127,276,388	T123I	probably damaging	Het
Deup1	A	C	9: 15,575,301	I455S	probably damaging	Het
Dnmbp	A	G	19: 43,868,864	V957A	possibly damaging	Het
Emilin2	T	C	17: 71,274,739	R331G	possibly damaging	Het
Eomes	A	G	9: 118,482,291	D394G	probably damaging	Het
Epn1	A	G	7: 5,097,602	N518S	probably damaging	Het
Gbf1	T	C	19: 46,163,618	I30T	probably benign	Het
Gcc1	A	G	6: 28,420,463	V285A	probably benign	Het
Gopc	T	C	10: 52,353,403	H188R	probably damaging	Het
Herc6	A	G	6: 57,654,401	N693D	probably benign	Het
Hipk2	A	G	6: 38,729,915		probably benign	Het
Htatsf1	G	T	X: 57,066,504	D642Y	unknown	Het
Ints1	G	A	5: 139,765,200	T814M	possibly damaging	Het
Kdm6a	T	C	X: 18,199,237	F104S	probably damaging	Het
Kdr	T	A	5: 75,949,519	Y936F	possibly damaging	Het
Ly6k	T	C	15: 74,797,169	E87G	probably benign	Het
Lyst	A	G	13: 13,743,263	N3303D	probably benign	Het
Mindy4	T	C	6: 55,301,070	F633S	probably damaging	Het
Msl2	T	A	9: 101,101,370	N314K	probably benign	Het
Ncapd3	A	G	9: 27,067,024	T840A	probably benign	Het
Neil3	T	C	8: 53,599,276	D429G	possibly damaging	Het
Nt5c1b	C	A	12: 10,375,558	T309K	probably damaging	Het
Nt5c1b	A	G	12: 10,390,108	Y550C	probably damaging	Het
Olfr1417	T	C	19: 11,828,450	D192G	probably damaging	Het
Pabpc4l	A	C	3: 46,446,702	V169G	probably damaging	Het
Pcgf5	A	T	19: 36,437,354	N105I	probably damaging	Het
Phka2	A	G	X: 160,541,412	E254G	probably damaging	Het
Pik3cb	A	G	9: 99,041,028	Y984H	probably damaging	Het
Ptprz1	A	T	6: 22,987,377	Q387L	probably damaging	Het
Rnf148	T	C	6: 23,654,346	Y217C	probably benign	Het
Sec24d	T	A	3: 123,349,894		probably null	Het
Sesn3	T	C	9: 14,308,465	V50A	probably benign	Het
Sgcd	T	C	11: 47,132,682	N99D	possibly damaging	Het
Sncaip	T	C	18: 52,868,547	S47P	probably damaging	Het
Sp2	C	T	11: 96,955,936	C527Y	probably damaging	Het
Spata4	A	C	8: 54,602,629	K185T	probably benign	Het
Spin2c	A	G	X: 153,833,676	I162V	probably damaging	Het
Srcin1	T	C	11: 97,534,819	T471A	probably benign	Het
Stac	G	A	9: 111,690,122		probably benign	Het
Tcaf3	A	G	6: 42,593,328	Y497H	probably benign	Het
Tmem40	C	T	6: 115,731,077	W150*	probably null	Het
Tmem59l	T	C	8: 70,485,122	T203A	probably damaging	Het
Tnfsf11	A	T	14: 78,299,981	S81T	possibly damaging	Het
Topaz1	C	T	9: 122,771,147	T984I	probably benign	Het
Vmn1r204	A	G	13: 22,556,823	H208R	probably benign	Het
Vmn2r98	T	A	17: 19,065,951	M237K	probably damaging	Het

Other mutations in Rassf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02973:Rassf8	APN	6	145817190	unclassified	probably benign
IGL03017:Rassf8	APN	6	145817198	splice site	probably null
IGL03091:Rassf8	APN	6	145815810	missense	probably benign	0.00
R0230:Rassf8	UTSW	6	145819974	unclassified	probably benign
R0967:Rassf8	UTSW	6	145819950	unclassified	probably benign
R1429:Rassf8	UTSW	6	145815190	missense	probably damaging	1.00
R1622:Rassf8	UTSW	6	145820103	unclassified	probably benign
R1738:Rassf8	UTSW	6	145815308	missense	probably benign	0.03
R1894:Rassf8	UTSW	6	145808473	missense	probably damaging	1.00
R2126:Rassf8	UTSW	6	145815182	missense	probably benign	0.00
R2439:Rassf8	UTSW	6	145815334	missense	probably damaging	1.00
R3699:Rassf8	UTSW	6	145820076	unclassified	probably benign
R4678:Rassf8	UTSW	6	145815082	missense	probably damaging	1.00
R4734:Rassf8	UTSW	6	145815540	missense	probably benign	0.34
R4826:Rassf8	UTSW	6	145816550	missense	probably damaging	1.00
R4910:Rassf8	UTSW	6	145815280	nonsense	probably null
R4988:Rassf8	UTSW	6	145817144	missense	possibly damaging	0.89
R5425:Rassf8	UTSW	6	145815542	missense	probably benign
R5620:Rassf8	UTSW	6	145820181	unclassified	probably benign
R5747:Rassf8	UTSW	6	145815815	missense	probably benign	0.00
R6136:Rassf8	UTSW	6	145815656	missense	probably benign	0.00
R6220:Rassf8	UTSW	6	145817133	missense	probably damaging	1.00
R7274:Rassf8	UTSW	6	145815569	missense	probably benign	0.03
R7315:Rassf8	UTSW	6	145815751	missense	probably benign
R7480:Rassf8	UTSW	6	145820031	missense	unknown
R7593:Rassf8	UTSW	6	145815403	missense	probably benign	0.08
R7714:Rassf8	UTSW	6	145815247	missense	probably damaging	0.98
R7962:Rassf8	UTSW	6	145815943	critical splice donor site	probably null
R8222:Rassf8	UTSW	6	145820057	missense	unknown
R8374:Rassf8	UTSW	6	145815137	nonsense	probably null
R8409:Rassf8	UTSW	6	145815703	missense	probably benign
Z1088:Rassf8	UTSW	6	145815482	missense	probably benign
Z1088:Rassf8	UTSW	6	145816616	missense	probably benign	0.41
Z1176:Rassf8	UTSW	6	145816642	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCAATGTAGTCTGCTCTTTCTGG -3'
(R):5'- CAGCTGCTGGACAACATGTC -3'

Sequencing Primer
(F):5'- CTTTGGGGAAGTTGACACATTTTC -3'
(R):5'- CATGTCAATACTGCGAAGAGTG -3'

Posted On

2014-10-15