Incidental Mutation 'R2238:Cnot1'
ID240241
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission 040238-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2238 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95769521 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 342 (I342V)
Ref Sequence ENSEMBL: ENSMUSP00000148735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]
Predicted Effect probably benign
Transcript: ENSMUST00000068452
AA Change: I342V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I342V

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: I342V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I342V

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: I340V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212228
Predicted Effect probably benign
Transcript: ENSMUST00000212323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212556
Predicted Effect probably benign
Transcript: ENSMUST00000213006
AA Change: I342V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,899 V5E possibly damaging Het
Acaca T C 11: 84,391,505 probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Bmi1 T C 2: 18,683,414 probably benign Het
Carf T C 1: 60,148,034 S599P probably benign Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Clca3a1 T A 3: 144,752,005 I373F possibly damaging Het
Clnk A G 5: 38,764,351 probably benign Het
Dact2 A T 17: 14,197,050 L296Q probably damaging Het
Dctn2 C T 10: 127,276,388 T123I probably damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dnmbp A G 19: 43,868,864 V957A possibly damaging Het
Emilin2 T C 17: 71,274,739 R331G possibly damaging Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gcc1 A G 6: 28,420,463 V285A probably benign Het
Gopc T C 10: 52,353,403 H188R probably damaging Het
Herc6 A G 6: 57,654,401 N693D probably benign Het
Hipk2 A G 6: 38,729,915 probably benign Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ints1 G A 5: 139,765,200 T814M possibly damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kdr T A 5: 75,949,519 Y936F possibly damaging Het
Ly6k T C 15: 74,797,169 E87G probably benign Het
Lyst A G 13: 13,743,263 N3303D probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Msl2 T A 9: 101,101,370 N314K probably benign Het
Ncapd3 A G 9: 27,067,024 T840A probably benign Het
Neil3 T C 8: 53,599,276 D429G possibly damaging Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5c1b A G 12: 10,390,108 Y550C probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Pabpc4l A C 3: 46,446,702 V169G probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Ptprz1 A T 6: 22,987,377 Q387L probably damaging Het
Rassf8 T C 6: 145,817,184 V419A probably damaging Het
Rnf148 T C 6: 23,654,346 Y217C probably benign Het
Sec24d T A 3: 123,349,894 probably null Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Sgcd T C 11: 47,132,682 N99D possibly damaging Het
Sncaip T C 18: 52,868,547 S47P probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Srcin1 T C 11: 97,534,819 T471A probably benign Het
Stac G A 9: 111,690,122 probably benign Het
Tcaf3 A G 6: 42,593,328 Y497H probably benign Het
Tmem40 C T 6: 115,731,077 W150* probably null Het
Tmem59l T C 8: 70,485,122 T203A probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Vmn1r204 A G 13: 22,556,823 H208R probably benign Het
Vmn2r98 T A 17: 19,065,951 M237K probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
barge UTSW 8 95734129 missense probably benign 0.13
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7940:Cnot1 UTSW 8 95745647 frame shift probably null
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACTTGTGCCAGTTTCAAGAAC -3'
(R):5'- GACGGTATTCCATTACAGGTTTG -3'

Sequencing Primer
(F):5'- TCTGCCATCATCAATAGACGGGTG -3'
(R):5'- CACTTTTACAGAGCATCTCT -3'
Posted On2014-10-15