Mutagenetix > Incidental Mutation

Incidental Mutation 'R2238:Cnot1'

240241

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

040238-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2238 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95769521 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 342 (I342V)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: I342V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I342V

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: I342V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I342V

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211887
AA Change: I340V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

probably benign
Transcript: ENSMUST00000212323

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212556

Predicted Effect

probably benign
Transcript: ENSMUST00000213006
AA Change: I342V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Meta Mutation Damage Score

0.0778

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (59/60)

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430007A20Rik	T	A	4: 144,519,899	V5E	possibly damaging	Het
Acaca	T	C	11: 84,391,505		probably benign	Het
Adam18	T	C	8: 24,646,287	E406G	probably benign	Het
Adgrl4	A	T	3: 151,500,142	I164F	probably damaging	Het
Arhgap36	G	T	X: 49,493,405	V60L	possibly damaging	Het
Bmi1	T	C	2: 18,683,414		probably benign	Het
Carf	T	C	1: 60,148,034	S599P	probably benign	Het
Cdc37	G	A	9: 21,142,533	Q176*	probably null	Het
Clca3a1	T	A	3: 144,752,005	I373F	possibly damaging	Het
Clnk	A	G	5: 38,764,351		probably benign	Het
Dact2	A	T	17: 14,197,050	L296Q	probably damaging	Het
Dctn2	C	T	10: 127,276,388	T123I	probably damaging	Het
Deup1	A	C	9: 15,575,301	I455S	probably damaging	Het
Dnmbp	A	G	19: 43,868,864	V957A	possibly damaging	Het
Emilin2	T	C	17: 71,274,739	R331G	possibly damaging	Het
Eomes	A	G	9: 118,482,291	D394G	probably damaging	Het
Epn1	A	G	7: 5,097,602	N518S	probably damaging	Het
Gbf1	T	C	19: 46,163,618	I30T	probably benign	Het
Gcc1	A	G	6: 28,420,463	V285A	probably benign	Het
Gopc	T	C	10: 52,353,403	H188R	probably damaging	Het
Herc6	A	G	6: 57,654,401	N693D	probably benign	Het
Hipk2	A	G	6: 38,729,915		probably benign	Het
Htatsf1	G	T	X: 57,066,504	D642Y	unknown	Het
Ints1	G	A	5: 139,765,200	T814M	possibly damaging	Het
Kdm6a	T	C	X: 18,199,237	F104S	probably damaging	Het
Kdr	T	A	5: 75,949,519	Y936F	possibly damaging	Het
Ly6k	T	C	15: 74,797,169	E87G	probably benign	Het
Lyst	A	G	13: 13,743,263	N3303D	probably benign	Het
Mindy4	T	C	6: 55,301,070	F633S	probably damaging	Het
Msl2	T	A	9: 101,101,370	N314K	probably benign	Het
Ncapd3	A	G	9: 27,067,024	T840A	probably benign	Het
Neil3	T	C	8: 53,599,276	D429G	possibly damaging	Het
Nt5c1b	C	A	12: 10,375,558	T309K	probably damaging	Het
Nt5c1b	A	G	12: 10,390,108	Y550C	probably damaging	Het
Olfr1417	T	C	19: 11,828,450	D192G	probably damaging	Het
Pabpc4l	A	C	3: 46,446,702	V169G	probably damaging	Het
Pcgf5	A	T	19: 36,437,354	N105I	probably damaging	Het
Phka2	A	G	X: 160,541,412	E254G	probably damaging	Het
Pik3cb	A	G	9: 99,041,028	Y984H	probably damaging	Het
Ptprz1	A	T	6: 22,987,377	Q387L	probably damaging	Het
Rassf8	T	C	6: 145,817,184	V419A	probably damaging	Het
Rnf148	T	C	6: 23,654,346	Y217C	probably benign	Het
Sec24d	T	A	3: 123,349,894		probably null	Het
Sesn3	T	C	9: 14,308,465	V50A	probably benign	Het
Sgcd	T	C	11: 47,132,682	N99D	possibly damaging	Het
Sncaip	T	C	18: 52,868,547	S47P	probably damaging	Het
Sp2	C	T	11: 96,955,936	C527Y	probably damaging	Het
Spata4	A	C	8: 54,602,629	K185T	probably benign	Het
Spin2c	A	G	X: 153,833,676	I162V	probably damaging	Het
Srcin1	T	C	11: 97,534,819	T471A	probably benign	Het
Stac	G	A	9: 111,690,122		probably benign	Het
Tcaf3	A	G	6: 42,593,328	Y497H	probably benign	Het
Tmem40	C	T	6: 115,731,077	W150*	probably null	Het
Tmem59l	T	C	8: 70,485,122	T203A	probably damaging	Het
Tnfsf11	A	T	14: 78,299,981	S81T	possibly damaging	Het
Topaz1	C	T	9: 122,771,147	T984I	probably benign	Het
Vmn1r204	A	G	13: 22,556,823	H208R	probably benign	Het
Vmn2r98	T	A	17: 19,065,951	M237K	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
Affiliate	UTSW	8	95765125	missense	probably damaging	0.99
Barge	UTSW	8	95734129	missense	probably benign	0.13
Byproduct	UTSW	8	95745647	frame shift	probably null
Chairman	UTSW	8	95765027	missense	possibly damaging	0.95
cohort	UTSW	8	95735749	missense	probably damaging	0.99
Director	UTSW	8	95765062	missense	probably benign	0.15
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
Quorum	UTSW	8	95726118	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
BB001:Cnot1	UTSW	8	95745647	frame shift	probably null
BB003:Cnot1	UTSW	8	95745647	frame shift	probably null
BB011:Cnot1	UTSW	8	95745647	frame shift	probably null
BB013:Cnot1	UTSW	8	95745647	frame shift	probably null
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7914:Cnot1	UTSW	8	95745647	frame shift	probably null
R7924:Cnot1	UTSW	8	95745647	frame shift	probably null
R7926:Cnot1	UTSW	8	95745647	frame shift	probably null
R7981:Cnot1	UTSW	8	95763169	missense	probably damaging	1.00
R8004:Cnot1	UTSW	8	95752752	missense	probably benign	0.03
R8061:Cnot1	UTSW	8	95765027	missense	possibly damaging	0.95
R8185:Cnot1	UTSW	8	95761351	missense	probably damaging	1.00
R8269:Cnot1	UTSW	8	95751761	missense	probably damaging	1.00
R8306:Cnot1	UTSW	8	95747021	missense	probably benign	0.05
R8322:Cnot1	UTSW	8	95769844	missense	probably benign	0.00
R8427:Cnot1	UTSW	8	95734324	missense	probably benign	0.01
R8723:Cnot1	UTSW	8	95736279	missense	probably benign	0.00
R8934:Cnot1	UTSW	8	95765067	missense	probably benign	0.04
R9025:Cnot1	UTSW	8	95749032	missense	probably benign
R9179:Cnot1	UTSW	8	95773426	missense	probably benign	0.16
R9280:Cnot1	UTSW	8	95770599	missense	probably benign	0.15
R9285:Cnot1	UTSW	8	95726118	missense	probably damaging	1.00
R9299:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9337:Cnot1	UTSW	8	95741820	missense	probably damaging	1.00
R9480:Cnot1	UTSW	8	95770710	missense	possibly damaging	0.94
R9548:Cnot1	UTSW	8	95756226	missense	probably benign	0.02
R9601:Cnot1	UTSW	8	95756207	missense	probably benign	0.02
R9629:Cnot1	UTSW	8	95729246	missense	probably damaging	0.98
R9752:Cnot1	UTSW	8	95761391	missense	probably damaging	1.00
R9764:Cnot1	UTSW	8	95769581	missense	probably benign	0.00
R9789:Cnot1	UTSW	8	95729144	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- ACTTGTGCCAGTTTCAAGAAC -3'
(R):5'- GACGGTATTCCATTACAGGTTTG -3'

Sequencing Primer
(F):5'- TCTGCCATCATCAATAGACGGGTG -3'
(R):5'- CACTTTTACAGAGCATCTCT -3'

Posted On

2014-10-15