Incidental Mutation 'R2238:Dact2'
ID 240265
Institutional Source Beutler Lab
Gene Symbol Dact2
Ensembl Gene ENSMUSG00000048826
Gene Name dishevelled-binding antagonist of beta-catenin 2
Synonyms dapper2, Dpr2, Frd2, 2900084M21Rik
MMRRC Submission 040238-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2238 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 14195231-14203831 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14197050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 296 (L296Q)
Ref Sequence ENSEMBL: ENSMUSP00000051638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053218]
AlphaFold Q7TN08
Predicted Effect probably damaging
Transcript: ENSMUST00000053218
AA Change: L296Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051638
Gene: ENSMUSG00000048826
AA Change: L296Q

DomainStartEndE-ValueType
Pfam:Dapper 19 757 1.8e-231 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele develop normally but display enhanced keratinocyte migration and accelerated re-epithelialization during cutaneous wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,899 V5E possibly damaging Het
Acaca T C 11: 84,391,505 probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Bmi1 T C 2: 18,683,414 probably benign Het
Carf T C 1: 60,148,034 S599P probably benign Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Clca3a1 T A 3: 144,752,005 I373F possibly damaging Het
Clnk A G 5: 38,764,351 probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Dctn2 C T 10: 127,276,388 T123I probably damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dnmbp A G 19: 43,868,864 V957A possibly damaging Het
Emilin2 T C 17: 71,274,739 R331G possibly damaging Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gcc1 A G 6: 28,420,463 V285A probably benign Het
Gopc T C 10: 52,353,403 H188R probably damaging Het
Herc6 A G 6: 57,654,401 N693D probably benign Het
Hipk2 A G 6: 38,729,915 probably benign Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ints1 G A 5: 139,765,200 T814M possibly damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kdr T A 5: 75,949,519 Y936F possibly damaging Het
Ly6k T C 15: 74,797,169 E87G probably benign Het
Lyst A G 13: 13,743,263 N3303D probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Msl2 T A 9: 101,101,370 N314K probably benign Het
Ncapd3 A G 9: 27,067,024 T840A probably benign Het
Neil3 T C 8: 53,599,276 D429G possibly damaging Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5c1b A G 12: 10,390,108 Y550C probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Pabpc4l A C 3: 46,446,702 V169G probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Ptprz1 A T 6: 22,987,377 Q387L probably damaging Het
Rassf8 T C 6: 145,817,184 V419A probably damaging Het
Rnf148 T C 6: 23,654,346 Y217C probably benign Het
Sec24d T A 3: 123,349,894 probably null Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Sgcd T C 11: 47,132,682 N99D possibly damaging Het
Sncaip T C 18: 52,868,547 S47P probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Srcin1 T C 11: 97,534,819 T471A probably benign Het
Stac G A 9: 111,690,122 probably benign Het
Tcaf3 A G 6: 42,593,328 Y497H probably benign Het
Tmem40 C T 6: 115,731,077 W150* probably null Het
Tmem59l T C 8: 70,485,122 T203A probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Vmn1r204 A G 13: 22,556,823 H208R probably benign Het
Vmn2r98 T A 17: 19,065,951 M237K probably damaging Het
Other mutations in Dact2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Dact2 APN 17 14195670 missense probably damaging 0.98
R0597:Dact2 UTSW 17 14197041 missense probably benign
R1657:Dact2 UTSW 17 14197990 missense probably benign 0.03
R1717:Dact2 UTSW 17 14197913 missense probably benign 0.11
R1734:Dact2 UTSW 17 14196639 missense probably benign 0.00
R1883:Dact2 UTSW 17 14197823 missense possibly damaging 0.81
R2878:Dact2 UTSW 17 14195914 missense probably damaging 1.00
R4290:Dact2 UTSW 17 14196571 missense probably benign 0.00
R4291:Dact2 UTSW 17 14196571 missense probably benign 0.00
R4902:Dact2 UTSW 17 14196729 missense possibly damaging 0.91
R5029:Dact2 UTSW 17 14195852 missense probably benign 0.00
R5084:Dact2 UTSW 17 14197952 missense possibly damaging 0.94
R5436:Dact2 UTSW 17 14195748 missense probably damaging 1.00
R5837:Dact2 UTSW 17 14196253 missense probably damaging 1.00
R5847:Dact2 UTSW 17 14199188 missense probably damaging 0.97
R6048:Dact2 UTSW 17 14197305 missense probably damaging 1.00
R6377:Dact2 UTSW 17 14199188 missense probably damaging 0.97
R7013:Dact2 UTSW 17 14203534 missense probably benign
R7268:Dact2 UTSW 17 14196535 missense probably benign 0.01
R7425:Dact2 UTSW 17 14196331 missense probably damaging 1.00
R8725:Dact2 UTSW 17 14196884 nonsense probably null
R8727:Dact2 UTSW 17 14196884 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCCAGCTGACATGTGCTC -3'
(R):5'- AGCTGGTACTGATGCTGCAC -3'

Sequencing Primer
(F):5'- AGCTGACATGTGCTCTCCGAC -3'
(R):5'- ATGCTGCACATCTCCTGGG -3'
Posted On 2014-10-15