Incidental Mutation 'R2238:Olfr1417'
ID240270
Institutional Source Beutler Lab
Gene Symbol Olfr1417
Ensembl Gene ENSMUSG00000048292
Gene Nameolfactory receptor 1417
SynonymsGA_x6K02T2RE5P-2172809-2171862, MOR266-2
MMRRC Submission 040238-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2238 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11826803-11839219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11828450 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 192 (D192G)
Ref Sequence ENSEMBL: ENSMUSP00000149141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061235] [ENSMUST00000214887]
Predicted Effect probably damaging
Transcript: ENSMUST00000061235
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062542
Gene: ENSMUSG00000048292
AA Change: D192G

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 3.3e-53 PFAM
Pfam:7tm_1 41 291 3.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213141
Predicted Effect probably damaging
Transcript: ENSMUST00000214887
AA Change: D192G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2045 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T A 4: 144,519,899 V5E possibly damaging Het
Acaca T C 11: 84,391,505 probably benign Het
Adam18 T C 8: 24,646,287 E406G probably benign Het
Adgrl4 A T 3: 151,500,142 I164F probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Bmi1 T C 2: 18,683,414 probably benign Het
Carf T C 1: 60,148,034 S599P probably benign Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Clca3a1 T A 3: 144,752,005 I373F possibly damaging Het
Clnk A G 5: 38,764,351 probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Dact2 A T 17: 14,197,050 L296Q probably damaging Het
Dctn2 C T 10: 127,276,388 T123I probably damaging Het
Deup1 A C 9: 15,575,301 I455S probably damaging Het
Dnmbp A G 19: 43,868,864 V957A possibly damaging Het
Emilin2 T C 17: 71,274,739 R331G possibly damaging Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gcc1 A G 6: 28,420,463 V285A probably benign Het
Gopc T C 10: 52,353,403 H188R probably damaging Het
Herc6 A G 6: 57,654,401 N693D probably benign Het
Hipk2 A G 6: 38,729,915 probably benign Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ints1 G A 5: 139,765,200 T814M possibly damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kdr T A 5: 75,949,519 Y936F possibly damaging Het
Ly6k T C 15: 74,797,169 E87G probably benign Het
Lyst A G 13: 13,743,263 N3303D probably benign Het
Mindy4 T C 6: 55,301,070 F633S probably damaging Het
Msl2 T A 9: 101,101,370 N314K probably benign Het
Ncapd3 A G 9: 27,067,024 T840A probably benign Het
Neil3 T C 8: 53,599,276 D429G possibly damaging Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Nt5c1b A G 12: 10,390,108 Y550C probably damaging Het
Pabpc4l A C 3: 46,446,702 V169G probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Pik3cb A G 9: 99,041,028 Y984H probably damaging Het
Ptprz1 A T 6: 22,987,377 Q387L probably damaging Het
Rassf8 T C 6: 145,817,184 V419A probably damaging Het
Rnf148 T C 6: 23,654,346 Y217C probably benign Het
Sec24d T A 3: 123,349,894 probably null Het
Sesn3 T C 9: 14,308,465 V50A probably benign Het
Sgcd T C 11: 47,132,682 N99D possibly damaging Het
Sncaip T C 18: 52,868,547 S47P probably damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Srcin1 T C 11: 97,534,819 T471A probably benign Het
Stac G A 9: 111,690,122 probably benign Het
Tcaf3 A G 6: 42,593,328 Y497H probably benign Het
Tmem40 C T 6: 115,731,077 W150* probably null Het
Tmem59l T C 8: 70,485,122 T203A probably damaging Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Vmn1r204 A G 13: 22,556,823 H208R probably benign Het
Vmn2r98 T A 17: 19,065,951 M237K probably damaging Het
Other mutations in Olfr1417
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0530:Olfr1417 UTSW 19 11828192 missense probably benign 0.26
R1532:Olfr1417 UTSW 19 11828619 missense probably benign 0.00
R1730:Olfr1417 UTSW 19 11828081 missense probably benign 0.06
R2032:Olfr1417 UTSW 19 11828300 missense probably damaging 1.00
R2237:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R2239:Olfr1417 UTSW 19 11828450 missense probably damaging 1.00
R4959:Olfr1417 UTSW 19 11828936 missense probably benign
R4973:Olfr1417 UTSW 19 11828936 missense probably benign
R5015:Olfr1417 UTSW 19 11828118 missense probably benign 0.00
R6799:Olfr1417 UTSW 19 11828814 missense possibly damaging 0.91
R6984:Olfr1417 UTSW 19 11828304 missense probably damaging 1.00
R7063:Olfr1417 UTSW 19 11828184 missense probably damaging 1.00
R7222:Olfr1417 UTSW 19 11828657 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATACTGCAGGAGGACAACG -3'
(R):5'- TATGACCGGTTTGTGGCCATC -3'

Sequencing Primer
(F):5'- CTGCAGGAGGACAACGGTCAG -3'
(R):5'- GCGCTATACCCTCATCATGAG -3'
Posted On2014-10-15