Mutagenetix > Incidental Mutation

Incidental Mutation 'R2238:Gbf1'

240273

Institutional Source

Beutler Lab

Gene Symbol

Gbf1

Ensembl Gene

ENSMUSG00000025224

Gene Name

golgi-specific brefeldin A-resistance factor 1

Synonyms

1700083E03Rik

MMRRC Submission

040238-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2238 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46152509-46286510 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46163618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 30 (I30T)

Ref Sequence

ENSEMBL: ENSMUSP00000026254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026254]

AlphaFold

Q6DFZ1

Predicted Effect

probably benign
Transcript: ENSMUST00000026254
AA Change: I30T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: I30T

Domain	Start	End	E-Value	Type
low complexity region	270	288	N/A	INTRINSIC
Pfam:Sec7_N	400	551	3.4e-29	PFAM
Sec7	696	884	8.55e-91	SMART
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1773	1793	N/A	INTRINSIC
low complexity region	1802	1820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175868

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176355

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177406

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430007A20Rik	T	A	4: 144,519,899	V5E	possibly damaging	Het
Acaca	T	C	11: 84,391,505		probably benign	Het
Adam18	T	C	8: 24,646,287	E406G	probably benign	Het
Adgrl4	A	T	3: 151,500,142	I164F	probably damaging	Het
Arhgap36	G	T	X: 49,493,405	V60L	possibly damaging	Het
Bmi1	T	C	2: 18,683,414		probably benign	Het
Carf	T	C	1: 60,148,034	S599P	probably benign	Het
Cdc37	G	A	9: 21,142,533	Q176*	probably null	Het
Clca3a1	T	A	3: 144,752,005	I373F	possibly damaging	Het
Clnk	A	G	5: 38,764,351		probably benign	Het
Cnot1	T	C	8: 95,769,521	I342V	probably benign	Het
Dact2	A	T	17: 14,197,050	L296Q	probably damaging	Het
Dctn2	C	T	10: 127,276,388	T123I	probably damaging	Het
Deup1	A	C	9: 15,575,301	I455S	probably damaging	Het
Dnmbp	A	G	19: 43,868,864	V957A	possibly damaging	Het
Emilin2	T	C	17: 71,274,739	R331G	possibly damaging	Het
Eomes	A	G	9: 118,482,291	D394G	probably damaging	Het
Epn1	A	G	7: 5,097,602	N518S	probably damaging	Het
Gcc1	A	G	6: 28,420,463	V285A	probably benign	Het
Gopc	T	C	10: 52,353,403	H188R	probably damaging	Het
Herc6	A	G	6: 57,654,401	N693D	probably benign	Het
Hipk2	A	G	6: 38,729,915		probably benign	Het
Htatsf1	G	T	X: 57,066,504	D642Y	unknown	Het
Ints1	G	A	5: 139,765,200	T814M	possibly damaging	Het
Kdm6a	T	C	X: 18,199,237	F104S	probably damaging	Het
Kdr	T	A	5: 75,949,519	Y936F	possibly damaging	Het
Ly6k	T	C	15: 74,797,169	E87G	probably benign	Het
Lyst	A	G	13: 13,743,263	N3303D	probably benign	Het
Mindy4	T	C	6: 55,301,070	F633S	probably damaging	Het
Msl2	T	A	9: 101,101,370	N314K	probably benign	Het
Ncapd3	A	G	9: 27,067,024	T840A	probably benign	Het
Neil3	T	C	8: 53,599,276	D429G	possibly damaging	Het
Nt5c1b	C	A	12: 10,375,558	T309K	probably damaging	Het
Nt5c1b	A	G	12: 10,390,108	Y550C	probably damaging	Het
Olfr1417	T	C	19: 11,828,450	D192G	probably damaging	Het
Pabpc4l	A	C	3: 46,446,702	V169G	probably damaging	Het
Pcgf5	A	T	19: 36,437,354	N105I	probably damaging	Het
Phka2	A	G	X: 160,541,412	E254G	probably damaging	Het
Pik3cb	A	G	9: 99,041,028	Y984H	probably damaging	Het
Ptprz1	A	T	6: 22,987,377	Q387L	probably damaging	Het
Rassf8	T	C	6: 145,817,184	V419A	probably damaging	Het
Rnf148	T	C	6: 23,654,346	Y217C	probably benign	Het
Sec24d	T	A	3: 123,349,894		probably null	Het
Sesn3	T	C	9: 14,308,465	V50A	probably benign	Het
Sgcd	T	C	11: 47,132,682	N99D	possibly damaging	Het
Sncaip	T	C	18: 52,868,547	S47P	probably damaging	Het
Sp2	C	T	11: 96,955,936	C527Y	probably damaging	Het
Spata4	A	C	8: 54,602,629	K185T	probably benign	Het
Spin2c	A	G	X: 153,833,676	I162V	probably damaging	Het
Srcin1	T	C	11: 97,534,819	T471A	probably benign	Het
Stac	G	A	9: 111,690,122		probably benign	Het
Tcaf3	A	G	6: 42,593,328	Y497H	probably benign	Het
Tmem40	C	T	6: 115,731,077	W150*	probably null	Het
Tmem59l	T	C	8: 70,485,122	T203A	probably damaging	Het
Tnfsf11	A	T	14: 78,299,981	S81T	possibly damaging	Het
Topaz1	C	T	9: 122,771,147	T984I	probably benign	Het
Vmn1r204	A	G	13: 22,556,823	H208R	probably benign	Het
Vmn2r98	T	A	17: 19,065,951	M237K	probably damaging	Het

Other mutations in Gbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00585:Gbf1	APN	19	46284249	critical splice acceptor site	probably null
IGL00988:Gbf1	APN	19	46284120	critical splice donor site	probably null
IGL01352:Gbf1	APN	19	46265215	missense	probably damaging	1.00
IGL01432:Gbf1	APN	19	46279995	missense	probably damaging	1.00
IGL01469:Gbf1	APN	19	46279364	missense	probably damaging	1.00
IGL01870:Gbf1	APN	19	46285669	missense	probably benign	0.00
IGL02019:Gbf1	APN	19	46279292	missense	possibly damaging	0.93
IGL02061:Gbf1	APN	19	46279258	missense	possibly damaging	0.65
IGL02126:Gbf1	APN	19	46252117	missense	probably damaging	0.97
IGL02272:Gbf1	APN	19	46269803	missense	probably damaging	1.00
IGL02346:Gbf1	APN	19	46285930	missense	probably damaging	1.00
IGL02491:Gbf1	APN	19	46262540	unclassified	probably benign
IGL03003:Gbf1	APN	19	46255655	missense	probably damaging	1.00
IGL03130:Gbf1	APN	19	46267348	missense	possibly damaging	0.82
IGL03376:Gbf1	APN	19	46262521	missense	possibly damaging	0.94
PIT4651001:Gbf1	UTSW	19	46163543	missense	probably benign
R0107:Gbf1	UTSW	19	46284828	missense	probably benign
R0139:Gbf1	UTSW	19	46261792	missense	probably damaging	1.00
R0180:Gbf1	UTSW	19	46285722	missense	probably benign
R0255:Gbf1	UTSW	19	46254110	splice site	probably benign
R0317:Gbf1	UTSW	19	46254020	missense	probably benign
R0329:Gbf1	UTSW	19	46272270	critical splice donor site	probably null
R0372:Gbf1	UTSW	19	46285704	missense	probably benign
R0666:Gbf1	UTSW	19	46262544	unclassified	probably benign
R1463:Gbf1	UTSW	19	46271545	unclassified	probably benign
R1701:Gbf1	UTSW	19	46261675	missense	probably damaging	1.00
R1848:Gbf1	UTSW	19	46272037	missense	possibly damaging	0.90
R1962:Gbf1	UTSW	19	46267219	missense	probably damaging	1.00
R1965:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R1966:Gbf1	UTSW	19	46271564	missense	probably damaging	1.00
R2177:Gbf1	UTSW	19	46265670	missense	probably benign
R2239:Gbf1	UTSW	19	46163618	missense	probably benign
R2520:Gbf1	UTSW	19	46265367	missense	probably benign
R3821:Gbf1	UTSW	19	46264807	missense	probably damaging	0.99
R4681:Gbf1	UTSW	19	46280550	missense	probably benign	0.41
R4695:Gbf1	UTSW	19	46259167	nonsense	probably null
R4785:Gbf1	UTSW	19	46268395	missense	possibly damaging	0.89
R5202:Gbf1	UTSW	19	46268454	missense	probably benign	0.13
R5359:Gbf1	UTSW	19	46283725	critical splice donor site	probably null
R5468:Gbf1	UTSW	19	46284296	missense	possibly damaging	0.92
R5593:Gbf1	UTSW	19	46272524	missense	possibly damaging	0.91
R5595:Gbf1	UTSW	19	46284422	missense	possibly damaging	0.74
R5796:Gbf1	UTSW	19	46284343	missense	probably benign	0.08
R5938:Gbf1	UTSW	19	46268452	missense	probably damaging	1.00
R5957:Gbf1	UTSW	19	46246221	critical splice donor site	probably null
R6059:Gbf1	UTSW	19	46265248	missense	probably damaging	1.00
R6120:Gbf1	UTSW	19	46279321	missense	possibly damaging	0.83
R6239:Gbf1	UTSW	19	46259696	missense	probably benign	0.00
R6252:Gbf1	UTSW	19	46271556	missense	probably benign	0.33
R6310:Gbf1	UTSW	19	46280005	missense	probably damaging	0.96
R6787:Gbf1	UTSW	19	46271772	missense	probably benign
R6805:Gbf1	UTSW	19	46262507	missense	probably damaging	1.00
R6855:Gbf1	UTSW	19	46279941	missense	probably benign	0.00
R7313:Gbf1	UTSW	19	46280354	missense	possibly damaging	0.94
R7414:Gbf1	UTSW	19	46283358	nonsense	probably null
R7646:Gbf1	UTSW	19	46283672	missense	probably damaging	1.00
R7650:Gbf1	UTSW	19	46272539	missense	probably damaging	1.00
R7789:Gbf1	UTSW	19	46254002	missense	probably damaging	1.00
R7801:Gbf1	UTSW	19	46272643	missense	probably benign	0.03
R8241:Gbf1	UTSW	19	46246137	missense	probably damaging	1.00
R8716:Gbf1	UTSW	19	46284021	missense	probably damaging	1.00
R8851:Gbf1	UTSW	19	46268483	missense	probably damaging	1.00
R9424:Gbf1	UTSW	19	46259683	missense	probably benign	0.00
R9435:Gbf1	UTSW	19	46279993	missense	probably benign	0.42
R9500:Gbf1	UTSW	19	46269950	missense	probably benign	0.01
R9567:Gbf1	UTSW	19	46271607	missense
R9576:Gbf1	UTSW	19	46259683	missense	probably benign	0.00
R9642:Gbf1	UTSW	19	46270268	missense	probably benign	0.00
R9680:Gbf1	UTSW	19	46283398	missense	probably damaging	0.96
R9760:Gbf1	UTSW	19	46255698	missense	probably benign	0.02
Z1177:Gbf1	UTSW	19	46259142	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTTGCAGGCTCAACATTTGT -3'
(R):5'- TCCCTATGAGCCAAGCATTAGA -3'

Sequencing Primer
(F):5'- GATCTCTGAGTTTGAGGCCAACC -3'
(R):5'- GCCAAGCATTAGAACATATGAGTC -3'

Posted On

2014-10-15