Incidental Mutation 'R2240:Col9a1'
ID240279
Institutional Source Beutler Lab
Gene Symbol Col9a1
Ensembl Gene ENSMUSG00000026147
Gene Namecollagen, type IX, alpha 1
SynonymsCol9a-1
MMRRC Submission 040240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R2240 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location24177610-24252684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24179501 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 65 (I65V)
Ref Sequence ENSEMBL: ENSMUSP00000051579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054588]
Predicted Effect unknown
Transcript: ENSMUST00000054588
AA Change: I65V
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147
AA Change: I65V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Abl1 A G 2: 31,800,505 K679E probably benign Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Brd4 T C 17: 32,213,639 probably benign Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nid2 G A 14: 19,805,914 D1236N probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Olfr866 A G 9: 20,027,144 S265P probably damaging Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Plec T C 15: 76,206,050 D30G probably damaging Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rab23 A G 1: 33,739,325 N216S probably benign Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rbbp8 C T 18: 11,677,669 T76I probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in Col9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Col9a1 APN 1 24185225 missense unknown
IGL00517:Col9a1 APN 1 24195534 intron probably benign
IGL01125:Col9a1 APN 1 24224645 critical splice acceptor site probably null
IGL01505:Col9a1 APN 1 24185124 missense unknown
IGL01583:Col9a1 APN 1 24185144 missense unknown
IGL01627:Col9a1 APN 1 24179608 critical splice donor site probably null
IGL01773:Col9a1 APN 1 24205066 missense probably benign 0.17
IGL02117:Col9a1 APN 1 24237493 nonsense probably null
IGL02192:Col9a1 APN 1 24221987 missense probably damaging 1.00
IGL02346:Col9a1 APN 1 24223609 missense probably damaging 0.96
IGL02383:Col9a1 APN 1 24185258 missense unknown
IGL02453:Col9a1 APN 1 24179357 missense unknown
IGL02553:Col9a1 APN 1 24221937 splice site probably benign
IGL03412:Col9a1 APN 1 24210427 critical splice donor site probably null
IGL03493:Col9a1 APN 1 24221570 splice site probably benign
ANU74:Col9a1 UTSW 1 24185328 missense unknown
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0090:Col9a1 UTSW 1 24223562 splice site probably null
R0356:Col9a1 UTSW 1 24185247 nonsense probably null
R0562:Col9a1 UTSW 1 24179279 splice site probably null
R0584:Col9a1 UTSW 1 24224490 splice site probably benign
R0708:Col9a1 UTSW 1 24237261 missense possibly damaging 0.92
R1342:Col9a1 UTSW 1 24223620 critical splice donor site probably null
R1445:Col9a1 UTSW 1 24237498 critical splice donor site probably null
R1791:Col9a1 UTSW 1 24185305 missense unknown
R1938:Col9a1 UTSW 1 24222473 missense probably damaging 1.00
R2214:Col9a1 UTSW 1 24208202 missense probably damaging 1.00
R3757:Col9a1 UTSW 1 24232231 critical splice donor site probably null
R3891:Col9a1 UTSW 1 24185436 critical splice donor site probably null
R4249:Col9a1 UTSW 1 24244381 missense probably damaging 1.00
R4690:Col9a1 UTSW 1 24224706 splice site probably null
R4918:Col9a1 UTSW 1 24237258 missense possibly damaging 0.74
R4988:Col9a1 UTSW 1 24185192 missense unknown
R5144:Col9a1 UTSW 1 24239353 missense probably benign 0.08
R5327:Col9a1 UTSW 1 24195539 critical splice donor site probably null
R5511:Col9a1 UTSW 1 24179538 missense unknown
R5519:Col9a1 UTSW 1 24230254 splice site probably null
R5564:Col9a1 UTSW 1 24195355 start gained probably benign
R6076:Col9a1 UTSW 1 24195376 start gained probably benign
R6478:Col9a1 UTSW 1 24185405 missense unknown
R6886:Col9a1 UTSW 1 24185345 missense unknown
R7177:Col9a1 UTSW 1 24195417 missense unknown
R7259:Col9a1 UTSW 1 24185343 missense unknown
R7268:Col9a1 UTSW 1 24207398 missense possibly damaging 0.89
R7347:Col9a1 UTSW 1 24179403 intron probably null
R7644:Col9a1 UTSW 1 24185162 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCAAGATCAGGATTGGCC -3'
(R):5'- TGACCTACCACTGAGCTGTC -3'

Sequencing Primer
(F):5'- TCAGGATTGGCCAAGATGACTTACC -3'
(R):5'- TTGTAAGGCTGTGGATCC -3'
Posted On2014-10-15