Incidental Mutation 'R2240:Rab23'
ID240280
Institutional Source Beutler Lab
Gene Symbol Rab23
Ensembl Gene ENSMUSG00000004768
Gene NameRAB23, member RAS oncogene family
Synonyms
MMRRC Submission 040240-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2240 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location33719887-33742564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33739325 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 216 (N216S)
Ref Sequence ENSEMBL: ENSMUSP00000110828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088287] [ENSMUST00000115174] [ENSMUST00000138024]
Predicted Effect probably benign
Transcript: ENSMUST00000088287
AA Change: N216S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085625
Gene: ENSMUSG00000004768
AA Change: N216S

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115174
AA Change: N216S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110828
Gene: ENSMUSG00000004768
AA Change: N216S

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132066
Predicted Effect probably benign
Transcript: ENSMUST00000138024
SMART Domains Protein: ENSMUSP00000137896
Gene: ENSMUSG00000004768

DomainStartEndE-ValueType
Pfam:Miro 11 59 1.9e-6 PFAM
Pfam:Ras 11 61 6.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151482
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a spontaneous allele show neural tube defects, exencephaly, spinal cord and dorsal root ganglia anomalies, malformed eyes and defects in the axial skeleton and developing limbs. Mice homozygous for an ENU-induced allele die in utero with exencephaly, polydactyly and eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Abl1 A G 2: 31,800,505 K679E probably benign Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Brd4 T C 17: 32,213,639 probably benign Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
Col9a1 A G 1: 24,179,501 I65V unknown Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nid2 G A 14: 19,805,914 D1236N probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Olfr866 A G 9: 20,027,144 S265P probably damaging Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Plec T C 15: 76,206,050 D30G probably damaging Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rbbp8 C T 18: 11,677,669 T76I probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in Rab23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02531:Rab23 APN 1 33738280 splice site probably benign
R0309:Rab23 UTSW 1 33734861 splice site probably null
R0798:Rab23 UTSW 1 33734827 missense probably damaging 0.99
R1549:Rab23 UTSW 1 33738297 missense possibly damaging 0.91
R1668:Rab23 UTSW 1 33734854 nonsense probably null
R1976:Rab23 UTSW 1 33723938 missense probably damaging 0.99
R2866:Rab23 UTSW 1 33738295 missense possibly damaging 0.75
R4476:Rab23 UTSW 1 33724892 intron probably benign
R4614:Rab23 UTSW 1 33739385 missense probably benign 0.01
R5884:Rab23 UTSW 1 33724886 intron probably benign
R5939:Rab23 UTSW 1 33723909 missense probably damaging 1.00
R7567:Rab23 UTSW 1 33734731 missense possibly damaging 0.91
X0018:Rab23 UTSW 1 33738336 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTGACCTTCCTGCTTAG -3'
(R):5'- CTTTCAGAGCGTGGTGAGAG -3'

Sequencing Primer
(F):5'- CGCTCTGTTCTAGTGCAGTAAGAAAC -3'
(R):5'- TGAGAGGCCCACGACAC -3'
Posted On2014-10-15