Incidental Mutation 'R2240:D430041D05Rik'
ID240291
Institutional Source Beutler Lab
Gene Symbol D430041D05Rik
Ensembl Gene ENSMUSG00000068373
Gene NameRIKEN cDNA D430041D05 gene
SynonymsG2
MMRRC Submission 040240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R2240 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location104143073-104411013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104156816 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1895 (R1895Q)
Ref Sequence ENSEMBL: ENSMUSP00000155485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089726] [ENSMUST00000136156] [ENSMUST00000141159] [ENSMUST00000230671]
Predicted Effect probably damaging
Transcript: ENSMUST00000089726
AA Change: R1210Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106756
Gene: ENSMUSG00000068373
AA Change: R1210Q

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 234 253 N/A INTRINSIC
Pfam:DUF3827 498 1134 2.4e-282 PFAM
low complexity region 1196 1217 N/A INTRINSIC
low complexity region 1331 1351 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136156
AA Change: R1211Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000141159
AA Change: R1096Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117041
Gene: ENSMUSG00000068373
AA Change: R1096Q

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 91 100 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
Pfam:DUF3827 383 1020 8.2e-280 PFAM
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1217 1237 N/A INTRINSIC
low complexity region 1246 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155458
Predicted Effect probably damaging
Transcript: ENSMUST00000230671
AA Change: R1895Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0880 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Abl1 A G 2: 31,800,505 K679E probably benign Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Brd4 T C 17: 32,213,639 probably benign Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
Col9a1 A G 1: 24,179,501 I65V unknown Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nid2 G A 14: 19,805,914 D1236N probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Olfr866 A G 9: 20,027,144 S265P probably damaging Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Plec T C 15: 76,206,050 D30G probably damaging Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rab23 A G 1: 33,739,325 N216S probably benign Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rbbp8 C T 18: 11,677,669 T76I probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in D430041D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:D430041D05Rik APN 2 104201303 missense probably damaging 1.00
IGL01114:D430041D05Rik APN 2 104258166 nonsense probably null
IGL01669:D430041D05Rik APN 2 104254961 missense probably damaging 1.00
IGL02015:D430041D05Rik APN 2 104230404 missense probably damaging 1.00
IGL02037:D430041D05Rik APN 2 104208214 splice site probably benign
IGL02268:D430041D05Rik APN 2 104241155 missense possibly damaging 0.80
IGL02294:D430041D05Rik APN 2 104255006 missense probably benign 0.42
IGL02457:D430041D05Rik APN 2 104249345 missense probably damaging 0.99
IGL02601:D430041D05Rik APN 2 104230286 missense probably damaging 0.99
IGL02647:D430041D05Rik APN 2 104248266 missense probably damaging 1.00
IGL02679:D430041D05Rik APN 2 104230305 missense possibly damaging 0.80
IGL02926:D430041D05Rik APN 2 104214259 missense probably damaging 1.00
IGL03171:D430041D05Rik APN 2 104241163 missense possibly damaging 0.95
IGL03178:D430041D05Rik APN 2 104221211 missense probably damaging 1.00
IGL03371:D430041D05Rik APN 2 104248374 missense probably damaging 1.00
R0027:D430041D05Rik UTSW 2 104255044 missense probably benign
R0064:D430041D05Rik UTSW 2 104249157 missense probably damaging 1.00
R0135:D430041D05Rik UTSW 2 104255034 missense possibly damaging 0.60
R0227:D430041D05Rik UTSW 2 104205200 missense possibly damaging 0.85
R0265:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0268:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0282:D430041D05Rik UTSW 2 104201244 missense probably damaging 1.00
R0366:D430041D05Rik UTSW 2 104255340 missense probably damaging 0.99
R0402:D430041D05Rik UTSW 2 104168164 missense probably damaging 0.99
R0436:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0441:D430041D05Rik UTSW 2 104167947 missense probably damaging 1.00
R0540:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0607:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0613:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0626:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0747:D430041D05Rik UTSW 2 104230306 missense probably damaging 1.00
R0864:D430041D05Rik UTSW 2 104230428 missense possibly damaging 0.78
R0980:D430041D05Rik UTSW 2 104249345 missense probably damaging 0.99
R1014:D430041D05Rik UTSW 2 104258329 missense possibly damaging 0.94
R1254:D430041D05Rik UTSW 2 104201303 missense probably damaging 1.00
R1364:D430041D05Rik UTSW 2 104155018 missense possibly damaging 0.93
R1456:D430041D05Rik UTSW 2 104208083 missense probably damaging 1.00
R1574:D430041D05Rik UTSW 2 104221208 small deletion probably benign
R1604:D430041D05Rik UTSW 2 104205142 missense probably damaging 1.00
R1605:D430041D05Rik UTSW 2 104255570 missense possibly damaging 0.46
R1623:D430041D05Rik UTSW 2 104152963 missense probably damaging 1.00
R1634:D430041D05Rik UTSW 2 104221211 missense probably damaging 1.00
R1834:D430041D05Rik UTSW 2 104168101 missense probably damaging 1.00
R1885:D430041D05Rik UTSW 2 104230455 missense probably benign 0.39
R2080:D430041D05Rik UTSW 2 104156816 missense probably damaging 1.00
R2101:D430041D05Rik UTSW 2 104148830 missense probably damaging 1.00
R2923:D430041D05Rik UTSW 2 104255315 missense possibly damaging 0.94
R3751:D430041D05Rik UTSW 2 104255058 missense possibly damaging 0.94
R3862:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3863:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3864:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3949:D430041D05Rik UTSW 2 104257368 missense probably benign 0.02
R4493:D430041D05Rik UTSW 2 104256339 missense probably benign 0.02
R4526:D430041D05Rik UTSW 2 104192433 critical splice donor site probably null
R4592:D430041D05Rik UTSW 2 104233479 missense possibly damaging 0.89
R4598:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4599:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4647:D430041D05Rik UTSW 2 104258443 missense probably damaging 0.99
R4765:D430041D05Rik UTSW 2 104214096 missense probably damaging 1.00
R4808:D430041D05Rik UTSW 2 104201110 critical splice donor site probably null
R4868:D430041D05Rik UTSW 2 104255409 missense possibly damaging 0.73
R4982:D430041D05Rik UTSW 2 104255387 missense possibly damaging 0.46
R5144:D430041D05Rik UTSW 2 104258502 missense probably damaging 0.99
R5255:D430041D05Rik UTSW 2 104256600 missense probably benign 0.26
R5356:D430041D05Rik UTSW 2 104255409 missense probably damaging 0.99
R5368:D430041D05Rik UTSW 2 104248284 missense probably damaging 0.99
R5963:D430041D05Rik UTSW 2 104248285 missense possibly damaging 0.66
R5993:D430041D05Rik UTSW 2 104168067 missense probably damaging 1.00
R6122:D430041D05Rik UTSW 2 104256292 missense probably benign 0.01
R6410:D430041D05Rik UTSW 2 104168203 splice site probably null
R6804:D430041D05Rik UTSW 2 104149026 missense possibly damaging 0.85
R6850:D430041D05Rik UTSW 2 104201259 missense probably damaging 1.00
R6853:D430041D05Rik UTSW 2 104241155 missense probably damaging 1.00
R7034:D430041D05Rik UTSW 2 104192538 missense probably damaging 0.99
R7146:D430041D05Rik UTSW 2 104258353 missense probably benign 0.06
R7250:D430041D05Rik UTSW 2 104256616 missense possibly damaging 0.92
R7251:D430041D05Rik UTSW 2 104221166 missense probably damaging 1.00
R7313:D430041D05Rik UTSW 2 104255565 missense probably benign
R7359:D430041D05Rik UTSW 2 104214137 missense probably damaging 1.00
R7361:D430041D05Rik UTSW 2 104255018 missense possibly damaging 0.46
R7436:D430041D05Rik UTSW 2 104257102 missense probably benign 0.02
R7472:D430041D05Rik UTSW 2 104410139 missense unknown
R7492:D430041D05Rik UTSW 2 104201305 missense probably damaging 1.00
R7631:D430041D05Rik UTSW 2 104149018 nonsense probably null
R7672:D430041D05Rik UTSW 2 104241236 missense probably benign 0.01
R7721:D430041D05Rik UTSW 2 104258529 missense probably benign 0.00
X0024:D430041D05Rik UTSW 2 104192566 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACGGAACCACCTTGAAGAG -3'
(R):5'- ATGTGATAAGACCGGGGATTGC -3'

Sequencing Primer
(F):5'- GGGGCAGGGACCAATAAACTC -3'
(R):5'- CCTGAAGGAAGATCTAGGGAACTCC -3'
Posted On2014-10-15