Mutagenetix > Incidental Mutations

Incidental Mutation 'R2240:Il12a'

240296

Institutional Source

Beutler Lab

Gene Symbol

Il12a

Ensembl Gene

ENSMUSG00000027776

Gene Name

interleukin 12a

Synonyms

IL-12p35, p35

MMRRC Submission

040240-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2240 (G1)

Quality Score

130

Status

Not validated

Chromosome

Chromosomal Location

68690644-68698547 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 68694184 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 58 (Y58*)

Ref Sequence

ENSEMBL: ENSMUSP00000103446 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]

Predicted Effect

probably null
Transcript: ENSMUST00000029345
AA Change: Y79*

SMART Domains

Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776
AA Change: Y79*

Domain	Start	End	E-Value	Type
low complexity region	1	26	N/A	INTRINSIC
Pfam:IL12	27	236	2.5e-106	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000107816
AA Change: Y58*

SMART Domains

Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776
AA Change: Y58*

Domain	Start	End	E-Value	Type
Pfam:IL12	1	215	6.8e-128	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191910

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195517

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	A	17: 24,376,443	I318N	probably damaging	Het
Abl1	A	G	2: 31,800,505	K679E	probably benign	Het
Actr8	A	G	14: 29,989,757	H420R	possibly damaging	Het
Arhgap29	T	A	3: 122,011,453	V897D	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bicc1	A	G	10: 70,946,803		probably null	Het
Brd4	T	C	17: 32,213,639		probably benign	Het
Camk2g	T	C	14: 20,765,446	E184G	probably damaging	Het
Camta1	T	C	4: 151,084,575	S240G	possibly damaging	Het
Cbx7	C	A	15: 79,918,357	A240S	probably damaging	Het
Ccdc181	A	T	1: 164,280,027	D93V	probably damaging	Het
Ces2g	A	C	8: 104,962,502	S37R	probably benign	Het
Clca1	T	A	3: 145,008,985	R624W	probably damaging	Het
Clca3b	T	C	3: 144,825,935	K703E	probably benign	Het
Clec2h	T	C	6: 128,675,882	V204A	probably benign	Het
Cltb	T	C	13: 54,599,154	N3S	possibly damaging	Het
Col9a1	A	G	1: 24,179,501	I65V	unknown	Het
D430041D05Rik	C	T	2: 104,156,816	R1895Q	probably damaging	Het
Dnah1	T	C	14: 31,299,974	S1191G	probably benign	Het
Ehf	G	A	2: 103,274,075	P163S	probably benign	Het
Fam170b	A	C	14: 32,835,868	H220P	probably damaging	Het
Fastkd1	G	A	2: 69,696,953	T598I	probably benign	Het
Fignl2	C	T	15: 101,054,035	G122D	probably damaging	Het
Foxp4	C	A	17: 47,871,276	V530L	unknown	Het
Gcnt1	G	T	19: 17,329,331	D343E	possibly damaging	Het
Gja8	T	G	3: 96,920,302	N15H	probably benign	Het
Gm128	T	C	3: 95,240,932	E17G	probably benign	Het
Gm13212	C	T	4: 145,585,321		probably benign	Het
Gnl1	T	C	17: 35,982,679	V252A	probably benign	Het
Gpld1	G	A	13: 24,982,507		probably null	Het
Gpr179	A	G	11: 97,351,733	L95P	probably damaging	Het
Gtf2a1	A	T	12: 91,586,739	D31E	possibly damaging	Het
Il1r2	T	C	1: 40,105,470	W106R	probably damaging	Het
Kif26b	A	G	1: 178,715,923	S374G	probably benign	Het
Mafb	A	T	2: 160,366,027	V217E	probably damaging	Het
Mapk13	T	A	17: 28,778,111	D292E	probably damaging	Het
Matn2	A	G	15: 34,433,063	D871G	probably damaging	Het
Mdn1	C	A	4: 32,765,701	T5220K	possibly damaging	Het
Mfsd6	T	C	1: 52,660,819	I723M	probably damaging	Het
Mfsd7a	A	G	5: 108,444,707	S234P	probably benign	Het
Mia2	G	A	12: 59,107,882	S127N	probably benign	Het
Mpeg1	A	C	19: 12,463,038	E620A	probably damaging	Het
Mrgprb3	A	T	7: 48,643,641	F54Y	probably damaging	Het
Mtx2	A	G	2: 74,869,352	I156V	probably benign	Het
Neurog1	T	C	13: 56,251,535	E133G	probably damaging	Het
Nid2	G	A	14: 19,805,914	D1236N	probably damaging	Het
Nif3l1	A	G	1: 58,452,129	T213A	probably benign	Het
Olfr866	A	G	9: 20,027,144	S265P	probably damaging	Het
Otog	A	G	7: 46,241,029	M1V	probably null	Het
Pde4dip	C	T	3: 97,724,164	R1143K	probably benign	Het
Pgam2	T	C	11: 5,803,265		probably benign	Het
Plec	T	C	15: 76,206,050	D30G	probably damaging	Het
Pramel5	C	A	4: 144,272,936	E194*	probably null	Het
Prss22	T	A	17: 23,996,781	S56C	probably damaging	Het
Rab23	A	G	1: 33,739,325	N216S	probably benign	Het
Rasgrf1	A	T	9: 89,976,762	E491V	probably damaging	Het
Rbbp8	C	T	18: 11,677,669	T76I	probably damaging	Het
Rtn2	G	A	7: 19,286,829		probably null	Het
Sdr39u1	A	T	14: 55,899,667	N62K	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Slc26a3	T	C	12: 31,457,072	V342A	probably damaging	Het
Snx30	G	T	4: 59,886,515	C308F	probably damaging	Het
Timd2	A	T	11: 46,678,216	V205E	probably benign	Het
Tmcc1	C	CAT	6: 116,042,870		probably null	Het
Tnfaip6	G	A	2: 52,050,914	D156N	probably benign	Het
Uggt2	T	A	14: 118,995,049	E1463D	probably damaging	Het
Urb2	C	A	8: 124,030,139	P862T	probably benign	Het
Vmn1r64	A	T	7: 5,884,370	L58*	probably null	Het
Vmn2r3	C	A	3: 64,259,062	G883C	probably benign	Het
Vps13d	A	T	4: 145,110,895	C2707S	possibly damaging	Het
Wdr11	G	T	7: 129,605,694		probably null	Het
Wdr37	T	A	13: 8,861,232		probably benign	Het
Wtap	G	A	17: 12,975,465	Q95*	probably null	Het
Zfp26	A	T	9: 20,437,267	L667H	probably damaging	Het

Other mutations in Il12a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01734:Il12a	APN	3	68691555	missense	possibly damaging	0.96
IGL01820:Il12a	APN	3	68692162	splice site	probably benign
IGL01989:Il12a	APN	3	68691576	splice site	probably benign
bakers_dozen	UTSW	3	68697987	frame shift	probably null
R0388:Il12a	UTSW	3	68695187	splice site	probably null
R0646:Il12a	UTSW	3	68697890	splice site	probably benign
R1083:Il12a	UTSW	3	68695333	missense	probably damaging	1.00
R1588:Il12a	UTSW	3	68695563	missense	probably benign	0.04
R2909:Il12a	UTSW	3	68697987	frame shift	probably null
R2925:Il12a	UTSW	3	68697987	frame shift	probably null
R3696:Il12a	UTSW	3	68697987	frame shift	probably null
R3697:Il12a	UTSW	3	68697987	frame shift	probably null
R3698:Il12a	UTSW	3	68697987	frame shift	probably null
R4332:Il12a	UTSW	3	68695261	intron	probably benign
R5809:Il12a	UTSW	3	68695262	intron	probably benign
R6279:Il12a	UTSW	3	68697979	missense	probably damaging	0.96
R6305:Il12a	UTSW	3	68694178	missense	possibly damaging	0.80
R6847:Il12a	UTSW	3	68695566	missense	probably damaging	1.00
R7751:Il12a	UTSW	3	68697902	missense	probably damaging	1.00
R8188:Il12a	UTSW	3	68691539	missense	unknown
R8339:Il12a	UTSW	3	68692105	nonsense	probably null
RF003:Il12a	UTSW	3	68695229	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAGCCTGAGTTTCCTACAGG -3'
(R):5'- CGAGTATATCCTTCAGCTTGTAGAAG -3'

Sequencing Primer
(F):5'- TGAGTTTCCTACAGGCCAAAG -3'
(R):5'- CTCTCACGTTTGATAGCTACAAG -3'

Posted On

2014-10-15