Mutagenetix > Incidental Mutations

Incidental Mutation 'R2240:Wdr11'

240320

Institutional Source

Beutler Lab

Gene Symbol

Wdr11

Ensembl Gene

ENSMUSG00000042055

Gene Name

WD repeat domain 11

Synonyms

Brwd2, Wdr11

MMRRC Submission

040240-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R2240 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129591863-129635738 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

G to T at 129605694 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000081567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084519]

Predicted Effect

probably null
Transcript: ENSMUST00000084519

SMART Domains

Protein: ENSMUSP00000081567
Gene: ENSMUSG00000042055

Domain	Start	End	E-Value	Type
WD40	50	99	2e-1	SMART
WD40	102	145	2.84e2	SMART
low complexity region	189	200	N/A	INTRINSIC
low complexity region	213	227	N/A	INTRINSIC
low complexity region	454	465	N/A	INTRINSIC
WD40	552	595	4.42e1	SMART
WD40	696	735	1.66e0	SMART
WD40	737	777	1.43e1	SMART
WD40	780	821	1.38e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143422

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143849

Predicted Effect

probably benign
Transcript: ENSMUST00000148752

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149541

Predicted Effect

probably benign
Transcript: ENSMUST00000206442

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is located in the chromosome 10q25-26 region, which is frequently deleted in gliomas and tumors of other tissues, and is disrupted by the t(10;19) translocation rearrangement in glioblastoma cells. The gene location suggests that it is a candidate gene for the tumor suppressor locus. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	A	17: 24,376,443	I318N	probably damaging	Het
Abl1	A	G	2: 31,800,505	K679E	probably benign	Het
Actr8	A	G	14: 29,989,757	H420R	possibly damaging	Het
Arhgap29	T	A	3: 122,011,453	V897D	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Bicc1	A	G	10: 70,946,803		probably null	Het
Brd4	T	C	17: 32,213,639		probably benign	Het
Camk2g	T	C	14: 20,765,446	E184G	probably damaging	Het
Camta1	T	C	4: 151,084,575	S240G	possibly damaging	Het
Cbx7	C	A	15: 79,918,357	A240S	probably damaging	Het
Ccdc181	A	T	1: 164,280,027	D93V	probably damaging	Het
Ces2g	A	C	8: 104,962,502	S37R	probably benign	Het
Clca1	T	A	3: 145,008,985	R624W	probably damaging	Het
Clca3b	T	C	3: 144,825,935	K703E	probably benign	Het
Clec2h	T	C	6: 128,675,882	V204A	probably benign	Het
Cltb	T	C	13: 54,599,154	N3S	possibly damaging	Het
Col9a1	A	G	1: 24,179,501	I65V	unknown	Het
D430041D05Rik	C	T	2: 104,156,816	R1895Q	probably damaging	Het
Dnah1	T	C	14: 31,299,974	S1191G	probably benign	Het
Ehf	G	A	2: 103,274,075	P163S	probably benign	Het
Fam170b	A	C	14: 32,835,868	H220P	probably damaging	Het
Fastkd1	G	A	2: 69,696,953	T598I	probably benign	Het
Fignl2	C	T	15: 101,054,035	G122D	probably damaging	Het
Foxp4	C	A	17: 47,871,276	V530L	unknown	Het
Gcnt1	G	T	19: 17,329,331	D343E	possibly damaging	Het
Gja8	T	G	3: 96,920,302	N15H	probably benign	Het
Gm128	T	C	3: 95,240,932	E17G	probably benign	Het
Gm13212	C	T	4: 145,585,321		probably benign	Het
Gnl1	T	C	17: 35,982,679	V252A	probably benign	Het
Gpld1	G	A	13: 24,982,507		probably null	Het
Gpr179	A	G	11: 97,351,733	L95P	probably damaging	Het
Gtf2a1	A	T	12: 91,586,739	D31E	possibly damaging	Het
Il12a	T	A	3: 68,694,184	Y58*	probably null	Het
Il1r2	T	C	1: 40,105,470	W106R	probably damaging	Het
Kif26b	A	G	1: 178,715,923	S374G	probably benign	Het
Mafb	A	T	2: 160,366,027	V217E	probably damaging	Het
Mapk13	T	A	17: 28,778,111	D292E	probably damaging	Het
Matn2	A	G	15: 34,433,063	D871G	probably damaging	Het
Mdn1	C	A	4: 32,765,701	T5220K	possibly damaging	Het
Mfsd6	T	C	1: 52,660,819	I723M	probably damaging	Het
Mfsd7a	A	G	5: 108,444,707	S234P	probably benign	Het
Mia2	G	A	12: 59,107,882	S127N	probably benign	Het
Mpeg1	A	C	19: 12,463,038	E620A	probably damaging	Het
Mrgprb3	A	T	7: 48,643,641	F54Y	probably damaging	Het
Mtx2	A	G	2: 74,869,352	I156V	probably benign	Het
Neurog1	T	C	13: 56,251,535	E133G	probably damaging	Het
Nid2	G	A	14: 19,805,914	D1236N	probably damaging	Het
Nif3l1	A	G	1: 58,452,129	T213A	probably benign	Het
Olfr866	A	G	9: 20,027,144	S265P	probably damaging	Het
Otog	A	G	7: 46,241,029	M1V	probably null	Het
Pde4dip	C	T	3: 97,724,164	R1143K	probably benign	Het
Pgam2	T	C	11: 5,803,265		probably benign	Het
Plec	T	C	15: 76,206,050	D30G	probably damaging	Het
Pramel5	C	A	4: 144,272,936	E194*	probably null	Het
Prss22	T	A	17: 23,996,781	S56C	probably damaging	Het
Rab23	A	G	1: 33,739,325	N216S	probably benign	Het
Rasgrf1	A	T	9: 89,976,762	E491V	probably damaging	Het
Rbbp8	C	T	18: 11,677,669	T76I	probably damaging	Het
Rtn2	G	A	7: 19,286,829		probably null	Het
Sdr39u1	A	T	14: 55,899,667	N62K	probably damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Slc26a3	T	C	12: 31,457,072	V342A	probably damaging	Het
Snx30	G	T	4: 59,886,515	C308F	probably damaging	Het
Timd2	A	T	11: 46,678,216	V205E	probably benign	Het
Tmcc1	C	CAT	6: 116,042,870		probably null	Het
Tnfaip6	G	A	2: 52,050,914	D156N	probably benign	Het
Uggt2	T	A	14: 118,995,049	E1463D	probably damaging	Het
Urb2	C	A	8: 124,030,139	P862T	probably benign	Het
Vmn1r64	A	T	7: 5,884,370	L58*	probably null	Het
Vmn2r3	C	A	3: 64,259,062	G883C	probably benign	Het
Vps13d	A	T	4: 145,110,895	C2707S	possibly damaging	Het
Wdr37	T	A	13: 8,861,232		probably benign	Het
Wtap	G	A	17: 12,975,465	Q95*	probably null	Het
Zfp26	A	T	9: 20,437,267	L667H	probably damaging	Het

Other mutations in Wdr11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Wdr11	APN	7	129593093	splice site	probably null
IGL01121:Wdr11	APN	7	129628022	missense	probably benign	0.02
IGL01385:Wdr11	APN	7	129607913	missense	probably benign
IGL01923:Wdr11	APN	7	129632322	critical splice acceptor site	probably null
IGL02274:Wdr11	APN	7	129631172	critical splice acceptor site	probably null
IGL02894:Wdr11	APN	7	129631166	splice site	probably benign
IGL02927:Wdr11	APN	7	129607098	critical splice donor site	probably null
IGL03008:Wdr11	APN	7	129606991	unclassified	probably benign
IGL03026:Wdr11	APN	7	129624336	missense	probably damaging	1.00
IGL03354:Wdr11	APN	7	129625302	missense	probably benign	0.01
IGL03379:Wdr11	APN	7	129599123	missense	probably damaging	1.00
Propeller	UTSW	7	129606675	missense	possibly damaging	0.91
R0003:Wdr11	UTSW	7	129599061	missense	probably damaging	1.00
R0928:Wdr11	UTSW	7	129606653	missense	probably damaging	1.00
R1170:Wdr11	UTSW	7	129607107	unclassified	probably benign
R1645:Wdr11	UTSW	7	129613889	missense	probably benign	0.29
R1908:Wdr11	UTSW	7	129605230	missense	possibly damaging	0.60
R1938:Wdr11	UTSW	7	129606607	missense	probably benign	0.08
R2122:Wdr11	UTSW	7	129631766	missense	probably damaging	1.00
R2148:Wdr11	UTSW	7	129629083	splice site	probably null
R2362:Wdr11	UTSW	7	129634836	missense	probably benign	0.05
R3774:Wdr11	UTSW	7	129631693	splice site	probably null
R4297:Wdr11	UTSW	7	129625186	missense	probably benign	0.18
R4546:Wdr11	UTSW	7	129629005	missense	probably damaging	1.00
R4787:Wdr11	UTSW	7	129608934	splice site	probably benign
R4789:Wdr11	UTSW	7	129618670	nonsense	probably null
R4807:Wdr11	UTSW	7	129628022	missense	probably benign	0.02
R4855:Wdr11	UTSW	7	129600434	splice site	probably null
R4898:Wdr11	UTSW	7	129633721	missense	probably benign
R5022:Wdr11	UTSW	7	129624711	missense	probably benign	0.10
R5326:Wdr11	UTSW	7	129625249	missense	probably damaging	1.00
R5398:Wdr11	UTSW	7	129631232	missense	probably damaging	1.00
R6120:Wdr11	UTSW	7	129624791	missense	probably damaging	0.99
R6136:Wdr11	UTSW	7	129618703	missense	possibly damaging	0.86
R6280:Wdr11	UTSW	7	129599106	nonsense	probably null
R6352:Wdr11	UTSW	7	129606675	missense	possibly damaging	0.91
R6432:Wdr11	UTSW	7	129606518	missense	possibly damaging	0.83
R6766:Wdr11	UTSW	7	129624312	missense	probably benign	0.02
R6911:Wdr11	UTSW	7	129607095	missense	probably benign	0.28
R7135:Wdr11	UTSW	7	129628106	missense	possibly damaging	0.76
R7151:Wdr11	UTSW	7	129606652	missense	probably damaging	1.00
R7463:Wdr11	UTSW	7	129607086	missense	probably damaging	0.99
R7503:Wdr11	UTSW	7	129603110	missense	probably benign
R8097:Wdr11	UTSW	7	129607887	missense	probably damaging	1.00
R8254:Wdr11	UTSW	7	129634836	missense	probably benign	0.02
R8354:Wdr11	UTSW	7	129602999	missense	probably damaging	0.99
R8377:Wdr11	UTSW	7	129606688	missense	possibly damaging	0.56
R8416:Wdr11	UTSW	7	129630679	missense	possibly damaging	0.62
Z1177:Wdr11	UTSW	7	129607878	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTAACTTACATAGGTGTCAATGAC -3'
(R):5'- ATGTCATCAACACAATTCCATGGG -3'

Sequencing Primer
(F):5'- GTCTCCTATGTTGTGCTTAT -3'
(R):5'- CCATGGGATACTTTATAAGCATCTTG -3'

Posted On

2014-10-15