Mutagenetix > Incidental Mutation

Incidental Mutation 'R0164:Sspo'

24033

Institutional Source

Beutler Lab

Gene Symbol

Sspo

Ensembl Gene

ENSMUSG00000029797

Gene Name

SCO-spondin

Synonyms

Scospondin, C79529

MMRRC Submission

038440-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0164 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48448229-48501250 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 48494194 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148570 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000185370] [ENSMUST00000188970] [ENSMUST00000212740]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000043676

SMART Domains

Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	126	135	N/A	INTRINSIC
Pfam:VWD	154	219	7.4e-11	PFAM
C8	267	346	2.3e-10	SMART
Pfam:TIL	349	404	3.2e-13	PFAM
VWC	406	448	2e-1	SMART
VWD	433	593	5.08e-29	SMART
C8	631	703	2.14e-28	SMART
Pfam:TIL	706	759	5.8e-11	PFAM
VWC	856	924	4.76e-2	SMART
VWD	883	1042	9.59e-48	SMART
C8	1076	1150	3.62e-26	SMART
Pfam:TIL	1153	1209	2.6e-13	PFAM
LDLa	1253	1291	2.29e-13	SMART
LDLa	1293	1328	1.87e-9	SMART
LDLa	1329	1366	5.77e-10	SMART
LDLa	1369	1408	1.52e-9	SMART
LDLa	1442	1479	2.55e-11	SMART
LDLa	1480	1520	5.6e-8	SMART
LDLa	1533	1574	2.29e-4	SMART
TSP1	1575	1626	6.47e-13	SMART
TSP1	1631	1686	1.35e-10	SMART
Pfam:TIL	1690	1746	3.1e-9	PFAM
TSP1	1774	1827	6.94e-2	SMART
VWC	1829	1886	4.95e-9	SMART
low complexity region	1901	1911	N/A	INTRINSIC
FA58C	1928	2085	1.4e-2	SMART
LDLa	2091	2128	1.48e-7	SMART
LDLa	2242	2279	5.68e-9	SMART
LDLa	2299	2336	5.77e-10	SMART
TSP1	2339	2389	1.42e-9	SMART
TSP1	2394	2446	6.36e-21	SMART
Pfam:TIL	2460	2511	5.7e-10	PFAM
VWC	2513	2567	2.48e-1	SMART
TSP1	2554	2605	3.07e-14	SMART
TSP1	2611	2664	4.05e-5	SMART
TSP1	2669	2719	1.83e-12	SMART
EGF_like	2733	2776	5.45e1	SMART
VWC	2783	2836	2.73e-11	SMART
TSP1	2823	2875	3.72e-13	SMART
TSP1	2878	2919	6.05e-4	SMART
Pfam:TIL	2926	2978	1.1e-11	PFAM
VWC	2980	3035	9.77e-2	SMART
TSP1	3022	3086	6.68e-6	SMART
TSP1	3091	3143	1.08e-14	SMART
Pfam:TIL	3147	3201	2.2e-9	PFAM
VWC	3203	3260	2.72e-1	SMART
TSP1	3247	3306	3.72e-4	SMART
TSP1	3311	3363	5.27e-4	SMART
Pfam:TIL	3365	3421	4.2e-9	PFAM
TSP1	3484	3529	1.87e-9	SMART
low complexity region	3591	3601	N/A	INTRINSIC
TSP1	3660	3713	5.02e-10	SMART
TSP1	3730	3779	2.95e-7	SMART
TSP1	3796	3849	1.99e-13	SMART
TSP1	3854	3906	2.51e-10	SMART
Pfam:TIL	3909	3964	3.4e-11	PFAM
VWC	3966	4022	1.26e0	SMART
TSP1	4009	4059	4.05e-5	SMART
TSP1	4103	4155	3.19e-12	SMART
TSP1	4161	4213	2.87e-2	SMART
TSP1	4218	4269	1.45e-6	SMART
Pfam:TIL	4273	4328	2.1e-10	PFAM
TSP1	4468	4516	7.56e-5	SMART
low complexity region	4551	4562	N/A	INTRINSIC
VWC	4578	4652	5.21e-1	SMART
TSP1	4619	4669	3.92e-12	SMART
Pfam:TIL	4671	4725	1.5e-11	PFAM
Pfam:TIL	4777	4835	3.1e-9	PFAM
VWC	4837	4892	1.8e-11	SMART
GHB	4904	4997	1.02e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169350

SMART Domains

Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	126	135	N/A	INTRINSIC
VWD	185	341	4.36e-28	SMART
C8	390	469	2.3e-10	SMART
Pfam:TIL	472	527	8.6e-13	PFAM
VWC	529	571	2e-1	SMART
VWD	556	716	5.08e-29	SMART
C8	754	826	2.14e-28	SMART
Pfam:TIL	829	882	1.6e-10	PFAM
VWC	979	1047	4.76e-2	SMART
VWD	1006	1165	9.59e-48	SMART
C8	1201	1275	3.62e-26	SMART
Pfam:TIL	1278	1334	7e-13	PFAM
LDLa	1378	1416	2.29e-13	SMART
LDLa	1418	1453	1.87e-9	SMART
LDLa	1454	1491	5.77e-10	SMART
LDLa	1494	1533	1.52e-9	SMART
LDLa	1567	1604	2.55e-11	SMART
LDLa	1605	1645	5.6e-8	SMART
LDLa	1658	1699	2.29e-4	SMART
TSP1	1700	1751	6.47e-13	SMART
TSP1	1756	1811	1.35e-10	SMART
Pfam:TIL	1815	1871	8.3e-9	PFAM
VWC	1873	1928	2.42e-1	SMART
TSP1	1915	1968	6.94e-2	SMART
VWC	1970	2027	4.95e-9	SMART
low complexity region	2042	2052	N/A	INTRINSIC
FA58C	2069	2226	1.4e-2	SMART
LDLa	2232	2269	1.48e-7	SMART
LDLa	2387	2424	5.68e-9	SMART
LDLa	2444	2481	5.77e-10	SMART
TSP1	2484	2534	1.42e-9	SMART
TSP1	2539	2591	6.36e-21	SMART
Pfam:TIL	2606	2656	1.8e-9	PFAM
VWC	2658	2712	2.48e-1	SMART
TSP1	2699	2750	3.07e-14	SMART
TSP1	2756	2809	4.05e-5	SMART
TSP1	2814	2864	1.83e-12	SMART
EGF_like	2878	2921	5.45e1	SMART
VWC	2928	2981	2.73e-11	SMART
TSP1	2968	3020	3.72e-13	SMART
TSP1	3023	3064	6.05e-4	SMART
Pfam:TIL	3071	3123	3e-11	PFAM
VWC	3125	3180	9.77e-2	SMART
TSP1	3167	3231	6.68e-6	SMART
TSP1	3236	3288	1.08e-14	SMART
Pfam:TIL	3292	3346	6e-9	PFAM
VWC	3348	3405	2.72e-1	SMART
TSP1	3392	3451	3.72e-4	SMART
TSP1	3456	3508	5.27e-4	SMART
Pfam:TIL	3510	3566	1.1e-8	PFAM
TSP1	3629	3674	1.87e-9	SMART
low complexity region	3734	3744	N/A	INTRINSIC
TSP1	3803	3856	5.02e-10	SMART
TSP1	3873	3922	2.95e-7	SMART
TSP1	3939	3992	1.99e-13	SMART
TSP1	3997	4049	2.51e-10	SMART
Pfam:TIL	4052	4107	9.1e-11	PFAM
VWC	4109	4165	1.26e0	SMART
TSP1	4152	4202	4.05e-5	SMART
TSP1	4246	4298	3.19e-12	SMART
TSP1	4304	4356	2.87e-2	SMART
TSP1	4361	4412	1.45e-6	SMART
Pfam:TIL	4416	4471	5.6e-10	PFAM
TSP1	4611	4659	7.56e-5	SMART
low complexity region	4694	4705	N/A	INTRINSIC
VWC	4721	4795	5.21e-1	SMART
TSP1	4762	4812	3.92e-12	SMART
Pfam:TIL	4814	4868	4e-11	PFAM
Pfam:TIL	4920	4978	8.4e-9	PFAM
VWC	4980	5035	1.8e-11	SMART
GHB	5050	5143	1.02e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185370

SMART Domains

Protein: ENSMUSP00000139484
Gene: ENSMUSG00000029797

Domain	Start	End	E-Value	Type
TSP1	28	80	1.2e-12	SMART
Pfam:TIL	83	138	3.8e-9	PFAM
VWC	140	196	6e-3	SMART
TSP1	183	233	1.9e-7	SMART
TSP1	277	329	1.5e-14	SMART
TSP1	335	387	1.4e-4	SMART
TSP1	392	443	6.8e-9	SMART
Pfam:TIL	447	502	2e-8	PFAM
Blast:TSP1	549	637	2e-11	BLAST
TSP1	642	690	3.7e-7	SMART
Pfam:TIL	694	750	1.3e-7	PFAM
VWC_def	752	826	2.5e-3	SMART
TSP1	793	843	1.9e-14	SMART
Pfam:TIL	845	899	2.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000188970

SMART Domains

Protein: ENSMUSP00000140642
Gene: ENSMUSG00000029797

Domain	Start	End	E-Value	Type
Pfam:TSP_1	1	40	9.4e-5	PFAM
TSP1	105	155	1.9e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212740

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.0%

Validation Efficiency

98% (85/87)

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	T	C	9: 124,295,159 (GRCm38)		probably benign	Het
4732465J04Rik	GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC	GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC	10: 95,794,578 (GRCm38)		probably null	Het
4930522L14Rik	T	C	5: 109,736,847 (GRCm38)	K382E	probably damaging	Het
Adck1	A	G	12: 88,455,510 (GRCm38)	E297G	probably damaging	Het
Ahrr	G	A	13: 74,283,024 (GRCm38)		probably benign	Het
Aldh3a2	C	T	11: 61,248,888 (GRCm38)	V473I	probably benign	Het
Arfgef3	A	T	10: 18,647,915 (GRCm38)	I369K	possibly damaging	Het
Atl2	A	G	17: 79,853,831 (GRCm38)		probably benign	Het
Atp1b3	T	C	9: 96,338,709 (GRCm38)	I178V	possibly damaging	Het
Axdnd1	T	C	1: 156,378,386 (GRCm38)	E520G	possibly damaging	Het
Bahcc1	A	T	11: 120,285,074 (GRCm38)		probably benign	Het
BB019430	A	T	10: 58,704,271 (GRCm38)		noncoding transcript	Het
BC028528	A	T	3: 95,887,334 (GRCm38)		probably benign	Het
Btbd1	T	A	7: 81,801,003 (GRCm38)	Q343L	probably benign	Het
Catsper1	A	G	19: 5,339,475 (GRCm38)	T473A	possibly damaging	Het
Chmp6	G	A	11: 119,915,523 (GRCm38)		probably null	Het
D130040H23Rik	T	C	8: 69,302,543 (GRCm38)	V200A	possibly damaging	Het
D830013O20Rik	C	T	12: 73,364,331 (GRCm38)		noncoding transcript	Het
Dcaf1	T	A	9: 106,844,145 (GRCm38)	S379T	possibly damaging	Het
Dcaf4	G	A	12: 83,535,988 (GRCm38)		probably benign	Het
Dhx58	T	C	11: 100,695,324 (GRCm38)	I624V	probably benign	Het
Disp3	T	C	4: 148,254,251 (GRCm38)	E821G	probably damaging	Het
Dlc1	T	A	8: 36,599,440 (GRCm38)	E464V	probably damaging	Het
Dnah10	G	A	5: 124,783,834 (GRCm38)	V2151I	probably damaging	Het
Dnah6	C	T	6: 73,188,535 (GRCm38)		probably benign	Het
Dnah8	G	A	17: 30,748,665 (GRCm38)	G2617D	probably benign	Het
Dnah9	C	A	11: 65,918,804 (GRCm38)	E872*	probably null	Het
Dock9	T	C	14: 121,597,665 (GRCm38)	Y99C	probably damaging	Het
Dpy19l3	T	A	7: 35,716,646 (GRCm38)	I310F	probably damaging	Het
Fggy	A	T	4: 95,837,654 (GRCm38)	I137F	probably damaging	Het
Gli2	A	G	1: 118,890,283 (GRCm38)		probably benign	Het
Gm14421	A	T	2: 177,056,722 (GRCm38)		noncoding transcript	Het
Gm5689	T	A	18: 42,173,543 (GRCm38)	D58E	probably damaging	Het
Grin2a	A	G	16: 9,994,821 (GRCm38)		probably null	Het
Grin2b	A	G	6: 135,778,648 (GRCm38)		probably benign	Het
Incenp	A	G	19: 9,894,879 (GRCm38)	S72P	probably benign	Het
Ipo11	A	G	13: 106,910,194 (GRCm38)		probably benign	Het
Klc3	T	A	7: 19,394,926 (GRCm38)	N469Y	possibly damaging	Het
Lrrc42	A	G	4: 107,247,505 (GRCm38)	S88P	probably benign	Het
Lrrc49	G	A	9: 60,680,600 (GRCm38)	T93I	probably benign	Het
Ltn1	G	A	16: 87,405,519 (GRCm38)		probably benign	Het
Mlycd	A	T	8: 119,407,641 (GRCm38)	Q294L	probably damaging	Het
Mmrn1	T	A	6: 60,975,815 (GRCm38)		probably benign	Het
Mrpl22	T	A	11: 58,171,821 (GRCm38)	I19N	probably benign	Het
Msh3	T	A	13: 92,349,209 (GRCm38)	K202N	probably damaging	Het
N4bp2	T	C	5: 65,803,573 (GRCm38)		probably benign	Het
Ncam1	C	T	9: 49,568,409 (GRCm38)	D90N	probably damaging	Het
Nckap5	A	T	1: 126,024,407 (GRCm38)	D1405E	possibly damaging	Het
Ncoa2	A	G	1: 13,186,731 (GRCm38)		probably null	Het
Ncoa6	TGC	TGCGC	2: 155,408,291 (GRCm38)		probably null	Het
Nlrp1b	A	T	11: 71,164,099 (GRCm38)	W844R	probably damaging	Het
Nmnat1	G	T	4: 149,469,150 (GRCm38)	N168K	possibly damaging	Het
Olfr1446	A	G	19: 12,890,445 (GRCm38)	L44P	probably damaging	Het
Ost4	T	C	5: 30,907,459 (GRCm38)	H26R	probably damaging	Het
Otog	G	A	7: 46,304,231 (GRCm38)	V2638M	probably damaging	Het
Otogl	A	T	10: 107,874,530 (GRCm38)	I566N	probably damaging	Het
Pcyt1a	T	C	16: 32,470,186 (GRCm38)	S282P	probably damaging	Het
Prkcg	G	A	7: 3,329,119 (GRCm38)	E581K	probably damaging	Het
Ralgps2	A	G	1: 156,887,089 (GRCm38)		probably null	Het
Rnf157	A	G	11: 116,354,810 (GRCm38)		probably benign	Het
Scmh1	T	C	4: 120,529,865 (GRCm38)		probably benign	Het
Sgo2b	T	C	8: 63,938,383 (GRCm38)	H150R	possibly damaging	Het
Sh2b3	T	G	5: 121,829,037 (GRCm38)	T5P	probably damaging	Het
Skint6	A	T	4: 112,991,236 (GRCm38)		probably benign	Het
Slfn10-ps	T	C	11: 83,035,302 (GRCm38)		noncoding transcript	Het
Tcp1	T	A	17: 12,922,747 (GRCm38)		probably benign	Het
Tdp2	A	G	13: 24,838,239 (GRCm38)	M214V	probably damaging	Het
Tenm4	T	G	7: 96,729,340 (GRCm38)		probably benign	Het
Tmem144	G	A	3: 79,839,273 (GRCm38)		probably benign	Het
Tmem204	A	G	17: 25,058,350 (GRCm38)	I187T	probably damaging	Het
Tmem208	T	G	8: 105,334,694 (GRCm38)	D117E	probably benign	Het
Tnks1bp1	C	T	2: 85,059,221 (GRCm38)	P631S	possibly damaging	Het
Tomm70a	T	C	16: 57,147,821 (GRCm38)	V517A	probably damaging	Het
Ttc7	T	C	17: 87,379,895 (GRCm38)	V801A	probably damaging	Het
Txndc5	A	T	13: 38,507,953 (GRCm38)	C146S	probably damaging	Het
Ubac2	A	G	14: 122,008,917 (GRCm38)		probably benign	Het
Ube4b	G	T	4: 149,360,324 (GRCm38)	T493K	probably damaging	Het
Ufl1	A	T	4: 25,256,008 (GRCm38)	Y504N	probably benign	Het
Ugt1a6a	T	C	1: 88,139,270 (GRCm38)	V266A	possibly damaging	Het
Ugt1a6b	T	A	1: 88,107,467 (GRCm38)	C176S	probably damaging	Het
Ulk3	T	A	9: 57,590,686 (GRCm38)	I90N	probably damaging	Het
Unc13c	T	C	9: 73,694,892 (GRCm38)	I1357M	probably benign	Het
Vmn1r28	G	A	6: 58,265,717 (GRCm38)	A182T	probably benign	Het
Vmn2r114	A	G	17: 23,309,826 (GRCm38)		probably null	Het
Vmn2r91	A	C	17: 18,106,137 (GRCm38)	N228T	probably benign	Het
Wdr43	T	G	17: 71,631,997 (GRCm38)		probably benign	Het
Wisp1	T	C	15: 66,919,210 (GRCm38)	L287P	probably damaging	Het
Zbtb6	G	T	2: 37,429,588 (GRCm38)	Y109*	probably null	Het
Zfp980	A	G	4: 145,701,997 (GRCm38)	D432G	probably benign	Het

Other mutations in Sspo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Sspo	APN	6	48,470,453 (GRCm38)	missense	probably benign	0.02
IGL00339:Sspo	APN	6	48,483,746 (GRCm38)	splice site	probably benign
IGL00391:Sspo	APN	6	48,497,386 (GRCm38)	missense	probably damaging	0.96
IGL00433:Sspo	APN	6	48,490,036 (GRCm38)	missense	probably damaging	1.00
IGL00471:Sspo	APN	6	48,498,213 (GRCm38)	splice site	probably benign
IGL00500:Sspo	APN	6	48,497,421 (GRCm38)	nonsense	probably null
IGL00537:Sspo	APN	6	48,498,213 (GRCm38)	splice site	probably benign
IGL00540:Sspo	APN	6	48,498,213 (GRCm38)	splice site	probably benign
IGL01060:Sspo	APN	6	48,449,479 (GRCm38)	nonsense	probably null
IGL01090:Sspo	APN	6	48,490,125 (GRCm38)	missense	probably benign	0.08
IGL01125:Sspo	APN	6	48,492,888 (GRCm38)	missense	probably damaging	1.00
IGL01447:Sspo	APN	6	48,464,666 (GRCm38)	splice site	probably null
IGL01457:Sspo	APN	6	48,498,343 (GRCm38)	missense	probably benign	0.00
IGL01481:Sspo	APN	6	48,448,515 (GRCm38)	missense	probably benign	0.41
IGL01485:Sspo	APN	6	48,478,731 (GRCm38)	missense	probably damaging	1.00
IGL01544:Sspo	APN	6	48,491,019 (GRCm38)	missense	probably damaging	0.99
IGL01575:Sspo	APN	6	48,459,042 (GRCm38)	missense	probably benign	0.01
IGL01589:Sspo	APN	6	48,451,178 (GRCm38)	missense	probably damaging	1.00
IGL01601:Sspo	APN	6	48,486,379 (GRCm38)	missense	probably benign	0.33
IGL01644:Sspo	APN	6	48,452,502 (GRCm38)	missense	probably benign
IGL01659:Sspo	APN	6	48,474,443 (GRCm38)	missense	probably damaging	1.00
IGL01801:Sspo	APN	6	48,457,138 (GRCm38)	missense	probably damaging	1.00
IGL01872:Sspo	APN	6	48,454,689 (GRCm38)	missense	probably damaging	0.99
IGL01874:Sspo	APN	6	48,452,190 (GRCm38)	missense	probably damaging	1.00
IGL01936:Sspo	APN	6	48,475,887 (GRCm38)	missense	probably damaging	1.00
IGL01941:Sspo	APN	6	48,495,182 (GRCm38)	missense	probably benign	0.19
IGL01986:Sspo	APN	6	48,483,303 (GRCm38)	missense	probably benign	0.05
IGL01987:Sspo	APN	6	48,477,624 (GRCm38)	splice site	probably null
IGL02170:Sspo	APN	6	48,467,983 (GRCm38)	missense	possibly damaging	0.76
IGL02192:Sspo	APN	6	48,459,568 (GRCm38)	missense	possibly damaging	0.86
IGL02210:Sspo	APN	6	48,500,492 (GRCm38)	missense	probably damaging	1.00
IGL02225:Sspo	APN	6	48,484,334 (GRCm38)	missense	probably benign	0.09
IGL02280:Sspo	APN	6	48,496,231 (GRCm38)	missense	probably damaging	1.00
IGL02303:Sspo	APN	6	48,484,705 (GRCm38)	missense	possibly damaging	0.52
IGL02397:Sspo	APN	6	48,461,638 (GRCm38)	missense	probably benign	0.35
IGL02451:Sspo	APN	6	48,460,303 (GRCm38)	splice site	probably benign
IGL02500:Sspo	APN	6	48,478,379 (GRCm38)	nonsense	probably null
IGL02519:Sspo	APN	6	48,484,828 (GRCm38)	missense	probably damaging	1.00
IGL02549:Sspo	APN	6	48,451,773 (GRCm38)	missense	possibly damaging	0.81
IGL02562:Sspo	APN	6	48,490,122 (GRCm38)	splice site	probably null
IGL02673:Sspo	APN	6	48,498,775 (GRCm38)	critical splice donor site	probably null
IGL02673:Sspo	APN	6	48,475,860 (GRCm38)	missense	probably damaging	1.00
IGL02719:Sspo	APN	6	48,482,667 (GRCm38)	missense	probably benign	0.39
IGL02793:Sspo	APN	6	48,487,894 (GRCm38)	splice site	probably benign
IGL03003:Sspo	APN	6	48,455,087 (GRCm38)	missense	probably damaging	0.98
IGL03056:Sspo	APN	6	48,470,538 (GRCm38)	missense	probably benign	0.17
IGL03105:Sspo	APN	6	48,473,658 (GRCm38)	splice site	probably benign
IGL03116:Sspo	APN	6	48,494,101 (GRCm38)	missense	probably benign	0.32
IGL03163:Sspo	APN	6	48,484,332 (GRCm38)	missense	probably benign	0.19
IGL03198:Sspo	APN	6	48,477,582 (GRCm38)	missense	probably benign	0.31
IGL03365:Sspo	APN	6	48,459,415 (GRCm38)	missense	possibly damaging	0.82
Barrier	UTSW	6	48,495,212 (GRCm38)	missense	possibly damaging	0.58
R0312_sspo_280	UTSW	6	48,455,401 (GRCm38)	missense	possibly damaging	0.52
R3112_Sspo_731	UTSW	6	48,457,600 (GRCm38)	missense	probably damaging	1.00
R3498_Sspo_650	UTSW	6	48,467,980 (GRCm38)	missense	possibly damaging	0.58
R4180_Sspo_324	UTSW	6	48,498,395 (GRCm38)	critical splice donor site	probably null
spotsylvania	UTSW	6	48,476,571 (GRCm38)	nonsense	probably null
ANU74:Sspo	UTSW	6	48,460,959 (GRCm38)	missense	probably damaging	1.00
IGL02984:Sspo	UTSW	6	48,495,155 (GRCm38)	missense	probably benign	0.33
IGL03052:Sspo	UTSW	6	48,460,453 (GRCm38)	missense	probably damaging	1.00
IGL03134:Sspo	UTSW	6	48,451,065 (GRCm38)	missense	probably benign	0.28
PIT4531001:Sspo	UTSW	6	48,481,239 (GRCm38)	missense	probably benign
R0087:Sspo	UTSW	6	48,477,785 (GRCm38)	missense	probably damaging	1.00
R0122:Sspo	UTSW	6	48,473,976 (GRCm38)	missense	possibly damaging	0.95
R0129:Sspo	UTSW	6	48,455,418 (GRCm38)	missense	probably benign	0.00
R0195:Sspo	UTSW	6	48,486,636 (GRCm38)	missense	probably benign
R0200:Sspo	UTSW	6	48,486,415 (GRCm38)	missense	probably null	0.01
R0201:Sspo	UTSW	6	48,455,752 (GRCm38)	missense	possibly damaging	0.64
R0241:Sspo	UTSW	6	48,461,495 (GRCm38)	missense	possibly damaging	0.82
R0241:Sspo	UTSW	6	48,461,495 (GRCm38)	missense	possibly damaging	0.82
R0243:Sspo	UTSW	6	48,493,186 (GRCm38)	missense	probably damaging	1.00
R0268:Sspo	UTSW	6	48,465,555 (GRCm38)	missense	probably benign	0.26
R0312:Sspo	UTSW	6	48,455,401 (GRCm38)	missense	possibly damaging	0.52
R0449:Sspo	UTSW	6	48,466,740 (GRCm38)	missense	probably damaging	1.00
R0523:Sspo	UTSW	6	48,451,860 (GRCm38)	missense	probably benign	0.20
R0576:Sspo	UTSW	6	48,464,942 (GRCm38)	splice site	probably null
R0671:Sspo	UTSW	6	48,490,391 (GRCm38)	splice site	probably benign
R0828:Sspo	UTSW	6	48,498,734 (GRCm38)	missense	probably damaging	1.00
R0880:Sspo	UTSW	6	48,475,935 (GRCm38)	missense	possibly damaging	0.69
R0903:Sspo	UTSW	6	48,455,308 (GRCm38)	critical splice acceptor site	probably null
R1051:Sspo	UTSW	6	48,491,455 (GRCm38)	nonsense	probably null
R1083:Sspo	UTSW	6	48,470,999 (GRCm38)	missense	possibly damaging	0.91
R1109:Sspo	UTSW	6	48,497,443 (GRCm38)	missense	probably damaging	1.00
R1118:Sspo	UTSW	6	48,459,418 (GRCm38)	missense	probably damaging	0.97
R1256:Sspo	UTSW	6	48,457,639 (GRCm38)	missense	probably damaging	1.00
R1342:Sspo	UTSW	6	48,461,635 (GRCm38)	missense	probably benign	0.07
R1355:Sspo	UTSW	6	48,448,626 (GRCm38)	missense	probably benign	0.41
R1370:Sspo	UTSW	6	48,448,626 (GRCm38)	missense	probably benign	0.41
R1469:Sspo	UTSW	6	48,490,982 (GRCm38)	missense	probably damaging	1.00
R1469:Sspo	UTSW	6	48,490,982 (GRCm38)	missense	probably damaging	1.00
R1476:Sspo	UTSW	6	48,463,400 (GRCm38)	critical splice donor site	probably null
R1566:Sspo	UTSW	6	48,466,870 (GRCm38)	critical splice donor site	probably null
R1630:Sspo	UTSW	6	48,457,724 (GRCm38)	missense	probably benign	0.01
R1686:Sspo	UTSW	6	48,460,400 (GRCm38)	missense	probably benign	0.00
R1707:Sspo	UTSW	6	48,477,877 (GRCm38)	missense	probably damaging	0.99
R1727:Sspo	UTSW	6	48,494,848 (GRCm38)	missense	probably damaging	1.00
R1822:Sspo	UTSW	6	48,492,886 (GRCm38)	missense	possibly damaging	0.75
R1831:Sspo	UTSW	6	48,489,786 (GRCm38)	missense	probably damaging	1.00
R1835:Sspo	UTSW	6	48,457,340 (GRCm38)	missense	probably damaging	0.97
R1862:Sspo	UTSW	6	48,491,006 (GRCm38)	missense	probably damaging	0.98
R1878:Sspo	UTSW	6	48,459,366 (GRCm38)	missense	possibly damaging	0.92
R1900:Sspo	UTSW	6	48,459,350 (GRCm38)	missense	probably benign	0.22
R1945:Sspo	UTSW	6	48,489,773 (GRCm38)	missense	possibly damaging	0.93
R1957:Sspo	UTSW	6	48,478,273 (GRCm38)	missense	probably damaging	0.99
R1990:Sspo	UTSW	6	48,451,050 (GRCm38)	missense	probably benign	0.00
R1996:Sspo	UTSW	6	48,475,490 (GRCm38)	missense	possibly damaging	0.50
R2049:Sspo	UTSW	6	48,463,531 (GRCm38)	missense	probably benign	0.36
R2049:Sspo	UTSW	6	48,460,763 (GRCm38)	splice site	probably benign
R2064:Sspo	UTSW	6	48,473,662 (GRCm38)	missense	probably damaging	0.99
R2072:Sspo	UTSW	6	48,473,517 (GRCm38)	missense	probably benign	0.01
R2096:Sspo	UTSW	6	48,461,674 (GRCm38)	missense	probably benign
R2106:Sspo	UTSW	6	48,466,316 (GRCm38)	missense	possibly damaging	0.96
R2230:Sspo	UTSW	6	48,500,503 (GRCm38)	missense	probably benign	0.11
R2230:Sspo	UTSW	6	48,448,672 (GRCm38)	missense	probably damaging	0.97
R2232:Sspo	UTSW	6	48,448,672 (GRCm38)	missense	probably damaging	0.97
R2351:Sspo	UTSW	6	48,464,869 (GRCm38)	missense	probably damaging	1.00
R2423:Sspo	UTSW	6	48,454,055 (GRCm38)	missense	probably benign	0.00
R2508:Sspo	UTSW	6	48,464,364 (GRCm38)	missense	probably damaging	1.00
R3110:Sspo	UTSW	6	48,457,600 (GRCm38)	missense	probably damaging	1.00
R3112:Sspo	UTSW	6	48,457,600 (GRCm38)	missense	probably damaging	1.00
R3413:Sspo	UTSW	6	48,480,697 (GRCm38)	missense	probably damaging	1.00
R3433:Sspo	UTSW	6	48,475,951 (GRCm38)	splice site	probably null
R3498:Sspo	UTSW	6	48,467,980 (GRCm38)	missense	possibly damaging	0.58
R3732:Sspo	UTSW	6	48,449,930 (GRCm38)	missense	probably damaging	1.00
R3816:Sspo	UTSW	6	48,481,103 (GRCm38)	missense	possibly damaging	0.77
R3818:Sspo	UTSW	6	48,481,103 (GRCm38)	missense	possibly damaging	0.77
R3819:Sspo	UTSW	6	48,481,103 (GRCm38)	missense	possibly damaging	0.77
R3838:Sspo	UTSW	6	48,480,820 (GRCm38)	missense	probably damaging	1.00
R3850:Sspo	UTSW	6	48,492,490 (GRCm38)	missense	probably damaging	1.00
R3880:Sspo	UTSW	6	48,494,940 (GRCm38)	missense	probably benign	0.38
R3893:Sspo	UTSW	6	48,476,571 (GRCm38)	nonsense	probably null
R4116:Sspo	UTSW	6	48,456,994 (GRCm38)	missense	probably damaging	0.99
R4179:Sspo	UTSW	6	48,498,395 (GRCm38)	critical splice donor site	probably null
R4180:Sspo	UTSW	6	48,498,395 (GRCm38)	critical splice donor site	probably null
R4207:Sspo	UTSW	6	48,478,293 (GRCm38)	missense	probably benign	0.00
R4210:Sspo	UTSW	6	48,464,901 (GRCm38)	missense	probably benign	0.00
R4223:Sspo	UTSW	6	48,451,157 (GRCm38)	missense	possibly damaging	0.54
R4224:Sspo	UTSW	6	48,451,157 (GRCm38)	missense	possibly damaging	0.54
R4225:Sspo	UTSW	6	48,451,157 (GRCm38)	missense	possibly damaging	0.54
R4229:Sspo	UTSW	6	48,490,934 (GRCm38)	missense	probably benign	0.00
R4230:Sspo	UTSW	6	48,490,934 (GRCm38)	missense	probably benign	0.00
R4363:Sspo	UTSW	6	48,498,731 (GRCm38)	missense	probably damaging	1.00
R4370:Sspo	UTSW	6	48,466,348 (GRCm38)	missense	probably null	0.14
R4407:Sspo	UTSW	6	48,460,520 (GRCm38)	missense	probably damaging	1.00
R4438:Sspo	UTSW	6	48,487,353 (GRCm38)	missense	probably damaging	1.00
R4454:Sspo	UTSW	6	48,487,225 (GRCm38)	missense	probably benign	0.05
R4455:Sspo	UTSW	6	48,465,516 (GRCm38)	missense	probably damaging	1.00
R4561:Sspo	UTSW	6	48,475,534 (GRCm38)	splice site	probably null
R4574:Sspo	UTSW	6	48,465,523 (GRCm38)	missense	probably damaging	1.00
R4578:Sspo	UTSW	6	48,463,373 (GRCm38)	missense	possibly damaging	0.58
R4653:Sspo	UTSW	6	48,478,646 (GRCm38)	missense	probably damaging	1.00
R4656:Sspo	UTSW	6	48,454,076 (GRCm38)	missense	possibly damaging	0.65
R4659:Sspo	UTSW	6	48,484,213 (GRCm38)	missense	probably damaging	1.00
R4664:Sspo	UTSW	6	48,473,534 (GRCm38)	missense	possibly damaging	0.82
R4685:Sspo	UTSW	6	48,492,894 (GRCm38)	missense	probably damaging	0.98
R4692:Sspo	UTSW	6	48,482,687 (GRCm38)	missense	probably damaging	1.00
R4703:Sspo	UTSW	6	48,500,453 (GRCm38)	missense	probably damaging	1.00
R4704:Sspo	UTSW	6	48,498,704 (GRCm38)	missense	probably damaging	1.00
R4738:Sspo	UTSW	6	48,478,396 (GRCm38)	missense	possibly damaging	0.78
R4766:Sspo	UTSW	6	48,470,580 (GRCm38)	missense	probably benign	0.04
R4771:Sspo	UTSW	6	48,460,879 (GRCm38)	missense	probably damaging	1.00
R4790:Sspo	UTSW	6	48,460,771 (GRCm38)	missense	probably benign	0.04
R4792:Sspo	UTSW	6	48,461,585 (GRCm38)	missense	probably benign	0.00
R4808:Sspo	UTSW	6	48,451,161 (GRCm38)	missense	probably damaging	1.00
R4812:Sspo	UTSW	6	48,490,510 (GRCm38)	missense	probably benign	0.00
R4883:Sspo	UTSW	6	48,460,822 (GRCm38)	missense	probably benign	0.00
R4906:Sspo	UTSW	6	48,465,730 (GRCm38)	critical splice acceptor site	probably null
R4934:Sspo	UTSW	6	48,465,552 (GRCm38)	missense	probably damaging	1.00
R4945:Sspo	UTSW	6	48,467,087 (GRCm38)	splice site	probably null
R4967:Sspo	UTSW	6	48,464,605 (GRCm38)	missense	probably damaging	0.97
R5016:Sspo	UTSW	6	48,452,280 (GRCm38)	nonsense	probably null
R5018:Sspo	UTSW	6	48,455,700 (GRCm38)	missense	probably damaging	1.00
R5034:Sspo	UTSW	6	48,480,823 (GRCm38)	missense	possibly damaging	0.93
R5044:Sspo	UTSW	6	48,466,955 (GRCm38)	critical splice acceptor site	probably null
R5055:Sspo	UTSW	6	48,464,795 (GRCm38)	missense	probably damaging	1.00
R5087:Sspo	UTSW	6	48,488,471 (GRCm38)	missense	possibly damaging	0.51
R5155:Sspo	UTSW	6	48,460,474 (GRCm38)	missense	probably benign	0.03
R5223:Sspo	UTSW	6	48,478,324 (GRCm38)	missense	probably damaging	1.00
R5249:Sspo	UTSW	6	48,493,310 (GRCm38)	missense	probably damaging	0.98
R5257:Sspo	UTSW	6	48,476,494 (GRCm38)	missense	probably damaging	1.00
R5258:Sspo	UTSW	6	48,476,494 (GRCm38)	missense	probably damaging	1.00
R5276:Sspo	UTSW	6	48,490,467 (GRCm38)	missense	probably damaging	1.00
R5307:Sspo	UTSW	6	48,454,850 (GRCm38)	missense	probably damaging	0.99
R5341:Sspo	UTSW	6	48,459,615 (GRCm38)	missense	probably damaging	1.00
R5361:Sspo	UTSW	6	48,466,313 (GRCm38)	missense	probably benign	0.02
R5385:Sspo	UTSW	6	48,462,253 (GRCm38)	missense	probably benign	0.18
R5394:Sspo	UTSW	6	48,495,260 (GRCm38)	missense	possibly damaging	0.52
R5477:Sspo	UTSW	6	48,498,393 (GRCm38)	missense	possibly damaging	0.60
R5490:Sspo	UTSW	6	48,493,280 (GRCm38)	missense	probably benign	0.33
R5512:Sspo	UTSW	6	48,455,671 (GRCm38)	missense	probably damaging	0.97
R5518:Sspo	UTSW	6	48,496,654 (GRCm38)	missense	possibly damaging	0.92
R5530:Sspo	UTSW	6	48,465,583 (GRCm38)	missense	probably damaging	0.97
R5538:Sspo	UTSW	6	48,452,178 (GRCm38)	missense	probably damaging	0.99
R5590:Sspo	UTSW	6	48,474,491 (GRCm38)	missense	probably damaging	1.00
R5613:Sspo	UTSW	6	48,455,044 (GRCm38)	missense	possibly damaging	0.79
R5638:Sspo	UTSW	6	48,492,891 (GRCm38)	missense	possibly damaging	0.86
R5809:Sspo	UTSW	6	48,460,045 (GRCm38)	missense	possibly damaging	0.59
R5810:Sspo	UTSW	6	48,483,898 (GRCm38)	missense	probably benign	0.02
R5814:Sspo	UTSW	6	48,451,884 (GRCm38)	missense	probably damaging	1.00
R5915:Sspo	UTSW	6	48,491,484 (GRCm38)	missense	possibly damaging	0.83
R5915:Sspo	UTSW	6	48,464,596 (GRCm38)	missense	probably benign	0.00
R5979:Sspo	UTSW	6	48,463,693 (GRCm38)	missense	probably benign	0.20
R5996:Sspo	UTSW	6	48,494,176 (GRCm38)	missense	possibly damaging	0.87
R6012:Sspo	UTSW	6	48,451,371 (GRCm38)	missense	probably benign	0.00
R6025:Sspo	UTSW	6	48,486,786 (GRCm38)	missense	possibly damaging	0.83
R6120:Sspo	UTSW	6	48,465,576 (GRCm38)	missense	probably damaging	1.00
R6150:Sspo	UTSW	6	48,486,379 (GRCm38)	missense	probably benign	0.33
R6221:Sspo	UTSW	6	48,463,705 (GRCm38)	missense	probably damaging	1.00
R6261:Sspo	UTSW	6	48,462,191 (GRCm38)	missense	possibly damaging	0.75
R6312:Sspo	UTSW	6	48,457,366 (GRCm38)	critical splice donor site	probably null
R6372:Sspo	UTSW	6	48,472,541 (GRCm38)	missense	probably damaging	1.00
R6456:Sspo	UTSW	6	48,451,806 (GRCm38)	missense	probably benign	0.08
R6497:Sspo	UTSW	6	48,495,208 (GRCm38)	missense	possibly damaging	0.71
R6501:Sspo	UTSW	6	48,495,212 (GRCm38)	missense	possibly damaging	0.58
R6617:Sspo	UTSW	6	48,491,046 (GRCm38)	missense	possibly damaging	0.93
R6825:Sspo	UTSW	6	48,465,525 (GRCm38)	missense	probably benign	0.04
R6831:Sspo	UTSW	6	48,484,833 (GRCm38)	missense	possibly damaging	0.68
R6861:Sspo	UTSW	6	48,487,955 (GRCm38)	missense	probably benign	0.15
R6961:Sspo	UTSW	6	48,463,877 (GRCm38)	missense	probably benign	0.05
R6967:Sspo	UTSW	6	48,489,794 (GRCm38)	missense	probably benign	0.21
R7016:Sspo	UTSW	6	48,449,164 (GRCm38)	missense	probably damaging	1.00
R7035:Sspo	UTSW	6	48,449,213 (GRCm38)	splice site	probably null
R7058:Sspo	UTSW	6	48,448,582 (GRCm38)	missense	probably damaging	1.00
R7072:Sspo	UTSW	6	48,454,979 (GRCm38)	missense	probably damaging	1.00
R7078:Sspo	UTSW	6	48,460,379 (GRCm38)	missense	probably damaging	1.00
R7082:Sspo	UTSW	6	48,478,609 (GRCm38)	critical splice acceptor site	probably null
R7120:Sspo	UTSW	6	48,465,571 (GRCm38)	missense	probably benign	0.05
R7127:Sspo	UTSW	6	48,449,512 (GRCm38)	missense	probably benign	0.02
R7146:Sspo	UTSW	6	48,501,095 (GRCm38)	missense	probably benign	0.15
R7220:Sspo	UTSW	6	48,476,606 (GRCm38)	nonsense	probably null
R7242:Sspo	UTSW	6	48,473,952 (GRCm38)	missense	probably benign
R7261:Sspo	UTSW	6	48,450,077 (GRCm38)	missense	possibly damaging	0.52
R7313:Sspo	UTSW	6	48,473,456 (GRCm38)	missense	probably benign	0.04
R7313:Sspo	UTSW	6	48,454,828 (GRCm38)	missense	probably damaging	1.00
R7323:Sspo	UTSW	6	48,461,647 (GRCm38)	missense	possibly damaging	0.93
R7330:Sspo	UTSW	6	48,475,462 (GRCm38)	missense	probably benign	0.00
R7351:Sspo	UTSW	6	48,464,921 (GRCm38)	missense	possibly damaging	0.89
R7467:Sspo	UTSW	6	48,486,303 (GRCm38)	missense	probably damaging	1.00
R7475:Sspo	UTSW	6	48,455,860 (GRCm38)	missense	probably benign	0.37
R7489:Sspo	UTSW	6	48,473,713 (GRCm38)	missense	probably damaging	0.99
R7508:Sspo	UTSW	6	48,466,699 (GRCm38)	missense	probably damaging	1.00
R7515:Sspo	UTSW	6	48,493,886 (GRCm38)	missense	probably damaging	1.00
R7564:Sspo	UTSW	6	48,449,500 (GRCm38)	missense	probably benign	0.04
R7607:Sspo	UTSW	6	48,489,727 (GRCm38)	missense	probably damaging	1.00
R7620:Sspo	UTSW	6	48,467,086 (GRCm38)	critical splice donor site	probably null
R7667:Sspo	UTSW	6	48,475,371 (GRCm38)	nonsense	probably null
R7691:Sspo	UTSW	6	48,484,229 (GRCm38)	missense	probably benign	0.12
R7707:Sspo	UTSW	6	48,461,527 (GRCm38)	missense	probably benign	0.01
R7723:Sspo	UTSW	6	48,464,638 (GRCm38)	missense	probably damaging	0.99
R7748:Sspo	UTSW	6	48,449,465 (GRCm38)	nonsense	probably null
R7767:Sspo	UTSW	6	48,451,382 (GRCm38)	missense	probably damaging	0.96
R7792:Sspo	UTSW	6	48,454,690 (GRCm38)	missense	probably damaging	0.98
R7878:Sspo	UTSW	6	48,492,526 (GRCm38)	missense	probably damaging	1.00
R7893:Sspo	UTSW	6	48,463,310 (GRCm38)	missense	probably benign	0.02
R7942:Sspo	UTSW	6	48,488,500 (GRCm38)	splice site	probably null
R7952:Sspo	UTSW	6	48,487,329 (GRCm38)	missense	probably damaging	1.00
R7981:Sspo	UTSW	6	48,468,494 (GRCm38)	missense	probably benign
R7995:Sspo	UTSW	6	48,492,889 (GRCm38)	missense	probably damaging	1.00
R8088:Sspo	UTSW	6	48,457,613 (GRCm38)	missense	probably damaging	1.00
R8129:Sspo	UTSW	6	48,467,025 (GRCm38)	missense	possibly damaging	0.79
R8145:Sspo	UTSW	6	48,467,749 (GRCm38)	missense	possibly damaging	0.49
R8202:Sspo	UTSW	6	48,457,600 (GRCm38)	missense	probably damaging	1.00
R8211:Sspo	UTSW	6	48,492,609 (GRCm38)	critical splice donor site	probably null
R8240:Sspo	UTSW	6	48,483,502 (GRCm38)	missense	possibly damaging	0.84
R8252:Sspo	UTSW	6	48,485,452 (GRCm38)	missense	probably damaging	0.99
R8270:Sspo	UTSW	6	48,449,963 (GRCm38)	missense	probably benign
R8272:Sspo	UTSW	6	48,448,519 (GRCm38)	missense	probably benign	0.03
R8316:Sspo	UTSW	6	48,482,688 (GRCm38)	missense	probably damaging	1.00
R8384:Sspo	UTSW	6	48,482,664 (GRCm38)	missense	probably damaging	1.00
R8390:Sspo	UTSW	6	48,467,962 (GRCm38)	missense	probably benign	0.00
R8770:Sspo	UTSW	6	48,474,272 (GRCm38)	missense	probably null	1.00
R8827:Sspo	UTSW	6	48,457,672 (GRCm38)	missense	possibly damaging	0.59
R8882:Sspo	UTSW	6	48,475,456 (GRCm38)	missense	probably damaging	1.00
R8886:Sspo	UTSW	6	48,481,267 (GRCm38)	missense	possibly damaging	0.92
R8946:Sspo	UTSW	6	48,457,137 (GRCm38)	missense	probably damaging	1.00
R8947:Sspo	UTSW	6	48,448,570 (GRCm38)	missense	probably damaging	1.00
R9028:Sspo	UTSW	6	48,496,153 (GRCm38)	missense	probably benign	0.38
R9043:Sspo	UTSW	6	48,493,280 (GRCm38)	missense	probably benign	0.07
R9056:Sspo	UTSW	6	48,473,674 (GRCm38)	missense	probably damaging	0.97
R9071:Sspo	UTSW	6	48,457,048 (GRCm38)	missense	probably benign	0.00
R9133:Sspo	UTSW	6	48,457,813 (GRCm38)	missense	possibly damaging	0.81
R9187:Sspo	UTSW	6	48,495,289 (GRCm38)	missense	probably damaging	1.00
R9205:Sspo	UTSW	6	48,455,872 (GRCm38)	missense	probably benign	0.03
R9213:Sspo	UTSW	6	48,463,935 (GRCm38)	missense	possibly damaging	0.91
R9214:Sspo	UTSW	6	48,463,935 (GRCm38)	missense	possibly damaging	0.91
R9215:Sspo	UTSW	6	48,463,935 (GRCm38)	missense	possibly damaging	0.91
R9235:Sspo	UTSW	6	48,489,784 (GRCm38)	missense	probably damaging	1.00
R9254:Sspo	UTSW	6	48,487,994 (GRCm38)	missense	probably damaging	1.00
R9291:Sspo	UTSW	6	48,496,396 (GRCm38)	missense	probably damaging	1.00
R9312:Sspo	UTSW	6	48,468,462 (GRCm38)	missense	probably benign	0.00
R9357:Sspo	UTSW	6	48,467,055 (GRCm38)	missense	possibly damaging	0.77
R9480:Sspo	UTSW	6	48,493,886 (GRCm38)	missense	probably damaging	1.00
R9586:Sspo	UTSW	6	48,481,105 (GRCm38)	missense	probably benign	0.03
R9660:Sspo	UTSW	6	48,455,773 (GRCm38)	missense	probably damaging	1.00
R9661:Sspo	UTSW	6	48,478,338 (GRCm38)	nonsense	probably null
R9728:Sspo	UTSW	6	48,455,773 (GRCm38)	missense	probably damaging	1.00
R9776:Sspo	UTSW	6	48,462,335 (GRCm38)	missense	probably benign	0.00
RF009:Sspo	UTSW	6	48,459,985 (GRCm38)	nonsense	probably null
X0060:Sspo	UTSW	6	48,480,794 (GRCm38)	missense	probably damaging	1.00
X0060:Sspo	UTSW	6	48,466,294 (GRCm38)	missense	probably damaging	1.00
X0063:Sspo	UTSW	6	48,497,422 (GRCm38)	missense	probably damaging	0.96
X0065:Sspo	UTSW	6	48,461,684 (GRCm38)	missense	probably benign	0.00
Z1176:Sspo	UTSW	6	48,481,293 (GRCm38)	missense	probably damaging	1.00
Z1177:Sspo	UTSW	6	48,490,890 (GRCm38)	missense	probably damaging	1.00
Z1177:Sspo	UTSW	6	48,490,548 (GRCm38)	nonsense	probably null
Z1177:Sspo	UTSW	6	48,473,435 (GRCm38)	missense	probably damaging	0.99
Z1177:Sspo	UTSW	6	48,470,984 (GRCm38)	missense	probably benign	0.16
Z1177:Sspo	UTSW	6	48,464,816 (GRCm38)	missense	possibly damaging	0.72
Z1177:Sspo	UTSW	6	48,457,026 (GRCm38)	missense	probably benign	0.31
Z1186:Sspo	UTSW	6	48,468,507 (GRCm38)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAACATTGGAAATGGCCCCTGAG -3'
(R):5'- TTTGATGGAGCCACTAGGAGGGAC -3'

Sequencing Primer
(F):5'- gcaccaatcccctgctc -3'
(R):5'- CCACTAGGAGGGACTCAGAG -3'

Posted On

2013-04-16