Incidental Mutation 'R2240:Plec'
ID240347
Institutional Source Beutler Lab
Gene Symbol Plec
Ensembl Gene ENSMUSG00000022565
Gene Nameplectin
SynonymsPlec1
MMRRC Submission 040240-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R2240 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76170974-76232574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76206050 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 30 (D30G)
Ref Sequence ENSEMBL: ENSMUSP00000126936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071869] [ENSMUST00000073418] [ENSMUST00000074834] [ENSMUST00000076442] [ENSMUST00000080857] [ENSMUST00000089610] [ENSMUST00000166428] [ENSMUST00000167754] [ENSMUST00000169289] [ENSMUST00000170915] [ENSMUST00000171562] [ENSMUST00000171634]
Predicted Effect probably benign
Transcript: ENSMUST00000071869
SMART Domains Protein: ENSMUSP00000071765
Gene: ENSMUSG00000022565

DomainStartEndE-ValueType
CH 22 121 4.57e-28 SMART
CH 138 236 3.52e-20 SMART
internal_repeat_2 271 353 1.13e-5 PROSPERO
internal_repeat_2 347 429 1.13e-5 PROSPERO
SPEC 494 591 3.08e-5 SMART
SPEC 594 694 1.29e-7 SMART
SPEC 700 862 3.01e0 SMART
low complexity region 941 955 N/A INTRINSIC
SPEC 958 1064 3.48e0 SMART
SPEC 1067 1178 7.63e-1 SMART
SPEC 1185 1345 2.59e-1 SMART
low complexity region 1349 1389 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
low complexity region 1446 1477 N/A INTRINSIC
low complexity region 1488 1537 N/A INTRINSIC
low complexity region 1579 1608 N/A INTRINSIC
low complexity region 1633 1658 N/A INTRINSIC
low complexity region 1696 1717 N/A INTRINSIC
low complexity region 1744 1808 N/A INTRINSIC
low complexity region 1824 1849 N/A INTRINSIC
low complexity region 1910 1924 N/A INTRINSIC
low complexity region 1938 1964 N/A INTRINSIC
low complexity region 1994 2028 N/A INTRINSIC
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2055 2083 N/A INTRINSIC
low complexity region 2092 2141 N/A INTRINSIC
low complexity region 2158 2173 N/A INTRINSIC
low complexity region 2261 2277 N/A INTRINSIC
low complexity region 2300 2318 N/A INTRINSIC
low complexity region 2369 2382 N/A INTRINSIC
low complexity region 2420 2450 N/A INTRINSIC
low complexity region 2503 2524 N/A INTRINSIC
low complexity region 2528 2543 N/A INTRINSIC
low complexity region 2545 2586 N/A INTRINSIC
PLEC 2625 2662 2.99e1 SMART
PLEC 2663 2700 4.49e-7 SMART
PLEC 2701 2738 4.49e-7 SMART
PLEC 2739 2776 3.54e-5 SMART
PLEC 2777 2814 3.27e-9 SMART
PLEC 2818 2852 6.31e-2 SMART
low complexity region 2923 2941 N/A INTRINSIC
PLEC 2953 2990 3.84e0 SMART
PLEC 2991 3028 1.59e-7 SMART
PLEC 3029 3066 3.54e-5 SMART
PLEC 3067 3104 8.64e-9 SMART
PLEC 3105 3142 1.53e-9 SMART
PLEC 3145 3180 2.18e2 SMART
low complexity region 3252 3271 N/A INTRINSIC
PLEC 3322 3359 3.22e-8 SMART
PLEC 3360 3397 7.82e-7 SMART
PLEC 3398 3435 1.9e-5 SMART
PLEC 3436 3473 7.01e-9 SMART
PLEC 3477 3511 3.38e-2 SMART
low complexity region 3523 3544 N/A INTRINSIC
low complexity region 3550 3560 N/A INTRINSIC
low complexity region 3593 3606 N/A INTRINSIC
PLEC 3657 3694 1.22e-8 SMART
PLEC 3695 3732 1.26e-10 SMART
PLEC 3733 3770 2.24e-7 SMART
PLEC 3771 3808 1.82e-7 SMART
PLEC 3812 3845 5.49e1 SMART
PLEC 3849 3882 3.2e2 SMART
PLEC 3900 3937 8.77e-10 SMART
PLEC 3938 3975 4.13e-6 SMART
PLEC 3976 4013 3.03e-4 SMART
PLEC 4014 4051 4.77e-11 SMART
PLEC 4055 4089 1.28e-2 SMART
PLEC 4102 4142 1.05e-7 SMART
low complexity region 4144 4154 N/A INTRINSIC
PLEC 4156 4193 1.73e1 SMART
low complexity region 4219 4234 N/A INTRINSIC
PLEC 4245 4282 3.65e-7 SMART
PLEC 4283 4320 9.99e-14 SMART
PLEC 4321 4358 4.71e-1 SMART
PLEC 4359 4396 2.44e-8 SMART
PLEC 4397 4434 2.87e-5 SMART
low complexity region 4444 4479 N/A INTRINSIC
low complexity region 4482 4508 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000073418
AA Change: D30G
SMART Domains Protein: ENSMUSP00000073124
Gene: ENSMUSG00000022565
AA Change: D30G

DomainStartEndE-ValueType
Pfam:S10_plectin 7 101 6.3e-34 PFAM
CH 187 291 5e-30 SMART
CH 308 406 1.8e-22 SMART
internal_repeat_2 441 523 2.49e-5 PROSPERO
internal_repeat_2 517 599 2.49e-5 PROSPERO
SPEC 664 761 1.9e-7 SMART
SPEC 764 864 8.4e-10 SMART
SPEC 870 1032 1.9e-2 SMART
low complexity region 1111 1125 N/A INTRINSIC
SPEC 1128 1234 2.3e-2 SMART
SPEC 1237 1348 4.9e-3 SMART
SPEC 1355 1515 1.7e-3 SMART
low complexity region 1519 1559 N/A INTRINSIC
low complexity region 1586 1603 N/A INTRINSIC
low complexity region 1616 1647 N/A INTRINSIC
low complexity region 1658 1707 N/A INTRINSIC
low complexity region 1749 1778 N/A INTRINSIC
low complexity region 1803 1828 N/A INTRINSIC
low complexity region 1866 1887 N/A INTRINSIC
low complexity region 1914 1978 N/A INTRINSIC
low complexity region 1994 2019 N/A INTRINSIC
low complexity region 2080 2094 N/A INTRINSIC
low complexity region 2108 2134 N/A INTRINSIC
low complexity region 2164 2198 N/A INTRINSIC
low complexity region 2204 2218 N/A INTRINSIC
low complexity region 2225 2253 N/A INTRINSIC
low complexity region 2262 2311 N/A INTRINSIC
low complexity region 2328 2343 N/A INTRINSIC
low complexity region 2431 2447 N/A INTRINSIC
low complexity region 2470 2488 N/A INTRINSIC
low complexity region 2539 2552 N/A INTRINSIC
low complexity region 2590 2620 N/A INTRINSIC
low complexity region 2673 2694 N/A INTRINSIC
low complexity region 2698 2713 N/A INTRINSIC
low complexity region 2715 2756 N/A INTRINSIC
PLEC 2795 2832 1.9e-1 SMART
PLEC 2833 2870 2.8e-9 SMART
PLEC 2871 2908 2.8e-9 SMART
PLEC 2909 2946 2.3e-7 SMART
PLEC 2947 2984 2e-11 SMART
PLEC 2988 3022 4e-4 SMART
low complexity region 3093 3111 N/A INTRINSIC
PLEC 3123 3160 2.5e-2 SMART
PLEC 3161 3198 1.1e-9 SMART
PLEC 3199 3236 2.2e-7 SMART
PLEC 3237 3274 5.7e-11 SMART
PLEC 3275 3312 1e-11 SMART
PLEC 3315 3350 1.4e0 SMART
low complexity region 3422 3441 N/A INTRINSIC
PLEC 3492 3529 2.1e-10 SMART
PLEC 3530 3567 5.1e-9 SMART
PLEC 3568 3605 1.2e-7 SMART
PLEC 3606 3643 4.6e-11 SMART
PLEC 3647 3681 2.2e-4 SMART
low complexity region 3693 3714 N/A INTRINSIC
low complexity region 3720 3730 N/A INTRINSIC
low complexity region 3763 3776 N/A INTRINSIC
PLEC 3827 3864 8.1e-11 SMART
PLEC 3865 3902 7.9e-13 SMART
PLEC 3903 3940 1.5e-9 SMART
PLEC 3941 3978 1.2e-9 SMART
PLEC 3982 4015 3.6e-1 SMART
PLEC 4019 4052 2e0 SMART
PLEC 4070 4107 5.7e-12 SMART
PLEC 4108 4145 2.7e-8 SMART
PLEC 4146 4183 1.9e-6 SMART
PLEC 4184 4221 3e-13 SMART
PLEC 4225 4259 8.1e-5 SMART
PLEC 4272 4312 6.5e-10 SMART
low complexity region 4314 4324 N/A INTRINSIC
PLEC 4326 4363 1.1e-1 SMART
low complexity region 4389 4404 N/A INTRINSIC
PLEC 4415 4452 2.3e-9 SMART
PLEC 4453 4490 6.4e-16 SMART
PLEC 4491 4528 3.1e-3 SMART
PLEC 4529 4566 1.5e-10 SMART
PLEC 4567 4604 1.8e-7 SMART
low complexity region 4614 4649 N/A INTRINSIC
low complexity region 4652 4678 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074834
SMART Domains Protein: ENSMUSP00000074383
Gene: ENSMUSG00000022565

DomainStartEndE-ValueType
CH 35 134 4.57e-28 SMART
CH 151 249 3.52e-20 SMART
internal_repeat_2 284 366 1.19e-5 PROSPERO
internal_repeat_2 360 442 1.19e-5 PROSPERO
SPEC 507 604 3.08e-5 SMART
SPEC 607 707 1.29e-7 SMART
SPEC 713 875 3.01e0 SMART
low complexity region 954 968 N/A INTRINSIC
SPEC 971 1077 3.48e0 SMART
SPEC 1080 1191 7.63e-1 SMART
SPEC 1198 1358 2.59e-1 SMART
low complexity region 1362 1402 N/A INTRINSIC
low complexity region 1429 1446 N/A INTRINSIC
low complexity region 1459 1490 N/A INTRINSIC
low complexity region 1501 1550 N/A INTRINSIC
low complexity region 1592 1621 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
low complexity region 1709 1730 N/A INTRINSIC
low complexity region 1757 1821 N/A INTRINSIC
low complexity region 1837 1862 N/A INTRINSIC
low complexity region 1923 1937 N/A INTRINSIC
low complexity region 1951 1977 N/A INTRINSIC
low complexity region 2007 2041 N/A INTRINSIC
low complexity region 2047 2061 N/A INTRINSIC
low complexity region 2068 2096 N/A INTRINSIC
low complexity region 2105 2154 N/A INTRINSIC
low complexity region 2171 2186 N/A INTRINSIC
low complexity region 2274 2290 N/A INTRINSIC
low complexity region 2313 2331 N/A INTRINSIC
low complexity region 2382 2395 N/A INTRINSIC
low complexity region 2433 2463 N/A INTRINSIC
low complexity region 2516 2537 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2558 2599 N/A INTRINSIC
PLEC 2638 2675 2.99e1 SMART
PLEC 2676 2713 4.49e-7 SMART
PLEC 2714 2751 4.49e-7 SMART
PLEC 2752 2789 3.54e-5 SMART
PLEC 2790 2827 3.27e-9 SMART
PLEC 2831 2865 6.31e-2 SMART
low complexity region 2936 2954 N/A INTRINSIC
PLEC 2966 3003 3.84e0 SMART
PLEC 3004 3041 1.59e-7 SMART
PLEC 3042 3079 3.54e-5 SMART
PLEC 3080 3117 8.64e-9 SMART
PLEC 3118 3155 1.53e-9 SMART
PLEC 3158 3193 2.18e2 SMART
low complexity region 3265 3284 N/A INTRINSIC
PLEC 3335 3372 3.22e-8 SMART
PLEC 3373 3410 7.82e-7 SMART
PLEC 3411 3448 1.9e-5 SMART
PLEC 3449 3486 7.01e-9 SMART
PLEC 3490 3524 3.38e-2 SMART
low complexity region 3536 3557 N/A INTRINSIC
low complexity region 3563 3573 N/A INTRINSIC
low complexity region 3606 3619 N/A INTRINSIC
PLEC 3670 3707 1.22e-8 SMART
PLEC 3708 3745 1.26e-10 SMART
PLEC 3746 3783 2.24e-7 SMART
PLEC 3784 3821 1.82e-7 SMART
PLEC 3825 3858 5.49e1 SMART
PLEC 3862 3895 3.2e2 SMART
PLEC 3913 3950 8.77e-10 SMART
PLEC 3951 3988 4.13e-6 SMART
PLEC 3989 4026 3.03e-4 SMART
PLEC 4027 4064 4.77e-11 SMART
PLEC 4068 4102 1.28e-2 SMART
PLEC 4115 4155 1.05e-7 SMART
low complexity region 4157 4167 N/A INTRINSIC
PLEC 4169 4206 1.73e1 SMART
low complexity region 4232 4247 N/A INTRINSIC
PLEC 4258 4295 3.65e-7 SMART
PLEC 4296 4333 9.99e-14 SMART
PLEC 4334 4371 4.71e-1 SMART
PLEC 4372 4409 2.44e-8 SMART
PLEC 4410 4447 2.87e-5 SMART
low complexity region 4457 4492 N/A INTRINSIC
low complexity region 4495 4521 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000076442
AA Change: D30G
SMART Domains Protein: ENSMUSP00000075772
Gene: ENSMUSG00000022565
AA Change: D30G

DomainStartEndE-ValueType
Pfam:S10_plectin 7 104 2.3e-37 PFAM
CH 187 286 4.57e-28 SMART
CH 303 401 3.52e-20 SMART
internal_repeat_2 436 518 2.42e-5 PROSPERO
internal_repeat_2 512 594 2.42e-5 PROSPERO
SPEC 659 756 3.08e-5 SMART
SPEC 759 859 1.29e-7 SMART
SPEC 865 1027 3.01e0 SMART
low complexity region 1106 1120 N/A INTRINSIC
SPEC 1123 1229 3.48e0 SMART
SPEC 1232 1343 7.63e-1 SMART
SPEC 1350 1510 2.59e-1 SMART
low complexity region 1514 1554 N/A INTRINSIC
low complexity region 1581 1598 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1653 1702 N/A INTRINSIC
low complexity region 1744 1773 N/A INTRINSIC
low complexity region 1798 1823 N/A INTRINSIC
low complexity region 1861 1882 N/A INTRINSIC
low complexity region 1909 1973 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
low complexity region 2075 2089 N/A INTRINSIC
low complexity region 2103 2129 N/A INTRINSIC
low complexity region 2159 2193 N/A INTRINSIC
low complexity region 2199 2213 N/A INTRINSIC
low complexity region 2220 2248 N/A INTRINSIC
low complexity region 2257 2306 N/A INTRINSIC
low complexity region 2323 2338 N/A INTRINSIC
low complexity region 2426 2442 N/A INTRINSIC
low complexity region 2465 2483 N/A INTRINSIC
low complexity region 2534 2547 N/A INTRINSIC
low complexity region 2585 2615 N/A INTRINSIC
low complexity region 2668 2689 N/A INTRINSIC
low complexity region 2693 2708 N/A INTRINSIC
low complexity region 2710 2751 N/A INTRINSIC
PLEC 2790 2827 2.99e1 SMART
PLEC 2828 2865 4.49e-7 SMART
PLEC 2866 2903 4.49e-7 SMART
PLEC 2904 2941 3.54e-5 SMART
PLEC 2942 2979 3.27e-9 SMART
PLEC 2983 3017 6.31e-2 SMART
low complexity region 3088 3106 N/A INTRINSIC
PLEC 3118 3155 3.84e0 SMART
PLEC 3156 3193 1.59e-7 SMART
PLEC 3194 3231 3.54e-5 SMART
PLEC 3232 3269 8.64e-9 SMART
PLEC 3270 3307 1.53e-9 SMART
PLEC 3310 3345 2.18e2 SMART
low complexity region 3417 3436 N/A INTRINSIC
PLEC 3487 3524 3.22e-8 SMART
PLEC 3525 3562 7.82e-7 SMART
PLEC 3563 3600 1.9e-5 SMART
PLEC 3601 3638 7.01e-9 SMART
PLEC 3642 3676 3.38e-2 SMART
low complexity region 3688 3709 N/A INTRINSIC
low complexity region 3715 3725 N/A INTRINSIC
low complexity region 3758 3771 N/A INTRINSIC
PLEC 3822 3859 1.22e-8 SMART
PLEC 3860 3897 1.26e-10 SMART
PLEC 3898 3935 2.24e-7 SMART
PLEC 3936 3973 1.82e-7 SMART
PLEC 3977 4010 5.49e1 SMART
PLEC 4014 4047 3.2e2 SMART
PLEC 4065 4102 8.77e-10 SMART
PLEC 4103 4140 4.13e-6 SMART
PLEC 4141 4178 3.03e-4 SMART
PLEC 4179 4216 4.77e-11 SMART
PLEC 4220 4254 1.28e-2 SMART
PLEC 4267 4307 1.05e-7 SMART
low complexity region 4309 4319 N/A INTRINSIC
PLEC 4321 4358 1.73e1 SMART
low complexity region 4384 4399 N/A INTRINSIC
PLEC 4410 4447 3.65e-7 SMART
PLEC 4448 4485 9.99e-14 SMART
PLEC 4486 4523 4.71e-1 SMART
PLEC 4524 4561 2.44e-8 SMART
PLEC 4562 4599 2.87e-5 SMART
low complexity region 4609 4644 N/A INTRINSIC
low complexity region 4647 4673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080857
SMART Domains Protein: ENSMUSP00000079668
Gene: ENSMUSG00000022565

DomainStartEndE-ValueType
CH 3 101 3.52e-20 SMART
internal_repeat_2 136 218 8.51e-6 PROSPERO
internal_repeat_2 212 294 8.51e-6 PROSPERO
SPEC 359 456 3.08e-5 SMART
SPEC 459 559 1.29e-7 SMART
SPEC 565 727 3.01e0 SMART
low complexity region 806 820 N/A INTRINSIC
SPEC 823 929 3.48e0 SMART
SPEC 932 1043 7.63e-1 SMART
SPEC 1050 1210 2.59e-1 SMART
low complexity region 1214 1254 N/A INTRINSIC
low complexity region 1281 1298 N/A INTRINSIC
low complexity region 1311 1342 N/A INTRINSIC
low complexity region 1353 1402 N/A INTRINSIC
low complexity region 1444 1473 N/A INTRINSIC
low complexity region 1498 1523 N/A INTRINSIC
low complexity region 1561 1582 N/A INTRINSIC
low complexity region 1609 1673 N/A INTRINSIC
low complexity region 1689 1714 N/A INTRINSIC
low complexity region 1775 1789 N/A INTRINSIC
low complexity region 1803 1829 N/A INTRINSIC
low complexity region 1859 1893 N/A INTRINSIC
low complexity region 1899 1913 N/A INTRINSIC
low complexity region 1920 1948 N/A INTRINSIC
low complexity region 1957 2006 N/A INTRINSIC
low complexity region 2023 2038 N/A INTRINSIC
low complexity region 2126 2142 N/A INTRINSIC
low complexity region 2165 2183 N/A INTRINSIC
low complexity region 2234 2247 N/A INTRINSIC
low complexity region 2285 2315 N/A INTRINSIC
low complexity region 2368 2389 N/A INTRINSIC
low complexity region 2393 2408 N/A INTRINSIC
low complexity region 2410 2451 N/A INTRINSIC
PLEC 2490 2527 2.99e1 SMART
PLEC 2528 2565 4.49e-7 SMART
PLEC 2566 2603 4.49e-7 SMART
PLEC 2604 2641 3.54e-5 SMART
PLEC 2642 2679 3.27e-9 SMART
PLEC 2683 2717 6.31e-2 SMART
low complexity region 2788 2806 N/A INTRINSIC
PLEC 2818 2855 3.84e0 SMART
PLEC 2856 2893 1.59e-7 SMART
PLEC 2894 2931 3.54e-5 SMART
PLEC 2932 2969 8.64e-9 SMART
PLEC 2970 3007 1.53e-9 SMART
PLEC 3010 3045 2.18e2 SMART
low complexity region 3117 3136 N/A INTRINSIC
PLEC 3187 3224 3.22e-8 SMART
PLEC 3225 3262 7.82e-7 SMART
PLEC 3263 3300 1.9e-5 SMART
PLEC 3301 3338 7.01e-9 SMART
PLEC 3342 3376 3.38e-2 SMART
low complexity region 3388 3409 N/A INTRINSIC
low complexity region 3415 3425 N/A INTRINSIC
low complexity region 3458 3471 N/A INTRINSIC
PLEC 3522 3559 1.22e-8 SMART
PLEC 3560 3597 1.26e-10 SMART
PLEC 3598 3635 2.24e-7 SMART
PLEC 3636 3673 1.82e-7 SMART
PLEC 3677 3710 5.49e1 SMART
PLEC 3714 3747 3.2e2 SMART
PLEC 3765 3802 8.77e-10 SMART
PLEC 3803 3840 4.13e-6 SMART
PLEC 3841 3878 3.03e-4 SMART
PLEC 3879 3916 4.77e-11 SMART
PLEC 3920 3954 1.28e-2 SMART
PLEC 3967 4007 1.05e-7 SMART
low complexity region 4009 4019 N/A INTRINSIC
PLEC 4021 4058 1.73e1 SMART
low complexity region 4084 4099 N/A INTRINSIC
PLEC 4110 4147 3.65e-7 SMART
PLEC 4148 4185 9.99e-14 SMART
PLEC 4186 4223 4.71e-1 SMART
PLEC 4224 4261 2.44e-8 SMART
PLEC 4262 4299 2.87e-5 SMART
low complexity region 4309 4344 N/A INTRINSIC
low complexity region 4347 4373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089610
SMART Domains Protein: ENSMUSP00000087037
Gene: ENSMUSG00000022565

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
CH 73 189 1.46e-26 SMART
CH 206 304 3.52e-20 SMART
internal_repeat_2 339 421 1.38e-5 PROSPERO
internal_repeat_2 415 497 1.38e-5 PROSPERO
SPEC 562 659 3.08e-5 SMART
SPEC 662 762 1.29e-7 SMART
SPEC 768 930 3.01e0 SMART
low complexity region 1009 1023 N/A INTRINSIC
SPEC 1026 1132 3.48e0 SMART
SPEC 1135 1246 7.63e-1 SMART
SPEC 1253 1413 2.59e-1 SMART
low complexity region 1417 1457 N/A INTRINSIC
low complexity region 1484 1501 N/A INTRINSIC
low complexity region 1514 1545 N/A INTRINSIC
low complexity region 1556 1605 N/A INTRINSIC
low complexity region 1647 1676 N/A INTRINSIC
low complexity region 1701 1726 N/A INTRINSIC
low complexity region 1764 1785 N/A INTRINSIC
low complexity region 1812 1876 N/A INTRINSIC
low complexity region 1892 1917 N/A INTRINSIC
low complexity region 1978 1992 N/A INTRINSIC
low complexity region 2006 2032 N/A INTRINSIC
low complexity region 2062 2096 N/A INTRINSIC
low complexity region 2102 2116 N/A INTRINSIC
low complexity region 2123 2151 N/A INTRINSIC
low complexity region 2160 2209 N/A INTRINSIC
low complexity region 2226 2241 N/A INTRINSIC
low complexity region 2329 2345 N/A INTRINSIC
low complexity region 2368 2386 N/A INTRINSIC
low complexity region 2437 2450 N/A INTRINSIC
low complexity region 2488 2518 N/A INTRINSIC
low complexity region 2571 2592 N/A INTRINSIC
low complexity region 2596 2611 N/A INTRINSIC
low complexity region 2613 2654 N/A INTRINSIC
PLEC 2693 2730 2.99e1 SMART
PLEC 2731 2768 4.49e-7 SMART
PLEC 2769 2806 4.49e-7 SMART
PLEC 2807 2844 3.54e-5 SMART
PLEC 2845 2882 3.27e-9 SMART
PLEC 2886 2920 6.31e-2 SMART
low complexity region 2991 3009 N/A INTRINSIC
PLEC 3021 3058 3.84e0 SMART
PLEC 3059 3096 1.59e-7 SMART
PLEC 3097 3134 3.54e-5 SMART
PLEC 3135 3172 8.64e-9 SMART
PLEC 3173 3210 1.53e-9 SMART
PLEC 3213 3248 2.18e2 SMART
low complexity region 3320 3339 N/A INTRINSIC
PLEC 3390 3427 3.22e-8 SMART
PLEC 3428 3465 7.82e-7 SMART
PLEC 3466 3503 1.9e-5 SMART
PLEC 3504 3541 7.01e-9 SMART
PLEC 3545 3579 3.38e-2 SMART
low complexity region 3591 3612 N/A INTRINSIC
low complexity region 3618 3628 N/A INTRINSIC
low complexity region 3661 3674 N/A INTRINSIC
PLEC 3725 3762 1.22e-8 SMART
PLEC 3763 3800 1.26e-10 SMART
PLEC 3801 3838 2.24e-7 SMART
PLEC 3839 3876 1.82e-7 SMART
PLEC 3880 3913 5.49e1 SMART
PLEC 3917 3950 3.2e2 SMART
PLEC 3968 4005 8.77e-10 SMART
PLEC 4006 4043 4.13e-6 SMART
PLEC 4044 4081 3.03e-4 SMART
PLEC 4082 4119 4.77e-11 SMART
PLEC 4123 4157 1.28e-2 SMART
PLEC 4170 4210 1.05e-7 SMART
low complexity region 4212 4222 N/A INTRINSIC
PLEC 4224 4261 1.73e1 SMART
low complexity region 4287 4302 N/A INTRINSIC
PLEC 4313 4350 3.65e-7 SMART
PLEC 4351 4388 9.99e-14 SMART
PLEC 4389 4426 4.71e-1 SMART
PLEC 4427 4464 2.44e-8 SMART
PLEC 4465 4502 2.87e-5 SMART
low complexity region 4512 4547 N/A INTRINSIC
low complexity region 4550 4576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166428
SMART Domains Protein: ENSMUSP00000130915
Gene: ENSMUSG00000022565

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
CH 73 189 1.46e-26 SMART
CH 206 304 3.52e-20 SMART
PDB:2ODU|A 318 549 1e-154 PDB
Blast:SPEC 328 431 3e-63 BLAST
SPEC 562 659 3.08e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167754
SMART Domains Protein: ENSMUSP00000127867
Gene: ENSMUSG00000022565

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
CH 73 189 1.46e-26 SMART
CH 206 304 3.52e-20 SMART
PDB:2ODU|A 318 549 1e-154 PDB
Blast:SPEC 328 431 3e-63 BLAST
SPEC 562 659 3.08e-5 SMART
low complexity region 677 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169289
SMART Domains Protein: ENSMUSP00000126912
Gene: ENSMUSG00000022565

DomainStartEndE-ValueType
CH 3 101 3.52e-20 SMART
PDB:2ODU|A 115 346 1e-157 PDB
SCOP:d1hcia1 119 234 7e-36 SMART
Blast:SPEC 125 228 6e-65 BLAST
SPEC 359 456 3.08e-5 SMART
low complexity region 474 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170915
SMART Domains Protein: ENSMUSP00000131946
Gene: ENSMUSG00000022565

DomainStartEndE-ValueType
PDB:1MB8|A 14 54 1e-21 PDB
SCOP:d1dxxa1 16 54 4e-10 SMART
Blast:CH 22 54 6e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171562
SMART Domains Protein: ENSMUSP00000129543
Gene: ENSMUSG00000022565

DomainStartEndE-ValueType
CH 3 101 3.52e-20 SMART
internal_repeat_2 136 218 8.51e-6 PROSPERO
internal_repeat_2 212 294 8.51e-6 PROSPERO
SPEC 359 456 3.08e-5 SMART
SPEC 459 559 1.29e-7 SMART
SPEC 565 727 3.01e0 SMART
low complexity region 806 820 N/A INTRINSIC
SPEC 823 929 3.48e0 SMART
SPEC 932 1043 7.63e-1 SMART
SPEC 1050 1210 2.59e-1 SMART
low complexity region 1214 1254 N/A INTRINSIC
low complexity region 1281 1298 N/A INTRINSIC
low complexity region 1311 1342 N/A INTRINSIC
low complexity region 1353 1402 N/A INTRINSIC
low complexity region 1444 1473 N/A INTRINSIC
low complexity region 1498 1523 N/A INTRINSIC
low complexity region 1561 1582 N/A INTRINSIC
low complexity region 1609 1673 N/A INTRINSIC
low complexity region 1689 1714 N/A INTRINSIC
low complexity region 1775 1789 N/A INTRINSIC
low complexity region 1803 1829 N/A INTRINSIC
low complexity region 1859 1893 N/A INTRINSIC
low complexity region 1899 1913 N/A INTRINSIC
low complexity region 1920 1948 N/A INTRINSIC
low complexity region 1957 2006 N/A INTRINSIC
low complexity region 2023 2038 N/A INTRINSIC
low complexity region 2126 2142 N/A INTRINSIC
low complexity region 2165 2183 N/A INTRINSIC
low complexity region 2234 2247 N/A INTRINSIC
low complexity region 2285 2315 N/A INTRINSIC
low complexity region 2368 2389 N/A INTRINSIC
low complexity region 2393 2408 N/A INTRINSIC
low complexity region 2410 2451 N/A INTRINSIC
PLEC 2490 2527 2.99e1 SMART
PLEC 2528 2565 4.49e-7 SMART
PLEC 2566 2603 4.49e-7 SMART
PLEC 2604 2641 3.54e-5 SMART
PLEC 2642 2679 3.27e-9 SMART
PLEC 2683 2717 6.31e-2 SMART
low complexity region 2788 2806 N/A INTRINSIC
PLEC 2818 2855 3.84e0 SMART
PLEC 2856 2893 1.59e-7 SMART
PLEC 2894 2931 3.54e-5 SMART
PLEC 2932 2969 8.64e-9 SMART
PLEC 2970 3007 1.53e-9 SMART
PLEC 3010 3045 2.18e2 SMART
low complexity region 3117 3136 N/A INTRINSIC
PLEC 3187 3224 3.22e-8 SMART
PLEC 3225 3262 7.82e-7 SMART
PLEC 3263 3300 1.9e-5 SMART
PLEC 3301 3338 7.01e-9 SMART
PLEC 3342 3376 3.38e-2 SMART
low complexity region 3388 3409 N/A INTRINSIC
low complexity region 3415 3425 N/A INTRINSIC
low complexity region 3458 3471 N/A INTRINSIC
PLEC 3522 3559 1.22e-8 SMART
PLEC 3560 3597 1.26e-10 SMART
PLEC 3598 3635 2.24e-7 SMART
PLEC 3636 3673 1.82e-7 SMART
PLEC 3677 3710 5.49e1 SMART
PLEC 3714 3747 3.2e2 SMART
PLEC 3765 3802 8.77e-10 SMART
PLEC 3803 3840 4.13e-6 SMART
PLEC 3841 3878 3.03e-4 SMART
PLEC 3879 3916 4.77e-11 SMART
PLEC 3920 3954 1.28e-2 SMART
PLEC 3967 4007 1.05e-7 SMART
low complexity region 4009 4019 N/A INTRINSIC
PLEC 4021 4058 1.73e1 SMART
low complexity region 4084 4099 N/A INTRINSIC
PLEC 4110 4147 3.65e-7 SMART
PLEC 4148 4185 9.99e-14 SMART
PLEC 4186 4223 4.71e-1 SMART
PLEC 4224 4261 2.44e-8 SMART
PLEC 4262 4299 2.87e-5 SMART
low complexity region 4309 4344 N/A INTRINSIC
low complexity region 4347 4373 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171634
AA Change: D30G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126936
Gene: ENSMUSG00000022565
AA Change: D30G

DomainStartEndE-ValueType
Pfam:S10_plectin 7 104 9.5e-38 PFAM
CH 187 291 9.8e-28 SMART
CH 308 406 3.52e-20 SMART
PDB:2ODU|A 420 651 1e-150 PDB
Blast:SPEC 430 533 2e-61 BLAST
SPEC 664 761 3.08e-5 SMART
SPEC 764 864 1.29e-7 SMART
coiled coil region 899 934 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Plectin is a prominent member of an important family of structurally and in part functionally related proteins, termed plakins or cytolinkers, that are capable of interlinking different elements of the cytoskeleton. Plakins, with their multi-domain structure and enormous size, not only play crucial roles in maintaining cell and tissue integrity and orchestrating dynamic changes in cytoarchitecture and cell shape, but also serve as scaffolding platforms for the assembly, positioning, and regulation of signaling complexes (reviewed in PMID: 9701547, 11854008, 17499243). Plectin is expressed as several protein isoforms in a wide range of cell types and tissues from a single gene located on chromosome 8 in humans (PMID: 8633055, 8698233). Until 2010, this locus was named plectin 1 (symbol PLEC1 in human; Plec1 in mouse and rat) and the gene product had been referred to as "hemidesmosomal protein 1" or "plectin 1, intermediate filament binding 500kDa". These names were superseded by plectin. The plectin gene locus in mouse on chromosome 15 has been analyzed in detail (PMID: 10556294, 14559777), revealing a genomic exon-intron organization with well over 40 exons spanning over 62 kb and an unusual 5' transcript complexity of plectin isoforms. Eleven exons (1-1j) have been identified that alternatively splice directly into a common exon 2 which is the first exon to encode plectin's highly conserved actin binding domain (ABD). Three additional exons (-1, 0a, and 0) splice into an alternative first coding exon (1c), and two additional exons (2alpha and 3alpha) are optionally spliced within the exons encoding the acting binding domain (exons 2-8). Analysis of the human locus has identified eight of the eleven alternative 5' exons found in mouse and rat (PMID: 14672974); exons 1i, 1j and 1h have not been confirmed in human. Furthermore, isoforms lacking the central rod domain encoded by exon 31 have been detected in mouse (PMID:10556294), rat (PMID: 9177781), and human (PMID: 11441066, 10780662, 20052759). It has been shown that the short alternative amino-terminal sequences encoded by the different first exons direct the targeting of the various isoforms to distinct subcellular locations (PMID: 14559777). As the expression of specific plectin isoforms was found to be dependent on cell type (tissue) and stage of development (PMID: 10556294, 12542521, 17389230) it appears that each cell type (tissue) contains a unique set (proportion and composition) of plectin isoforms, as if custom-made for specific requirements of the particular cells. Concordantly, individual isoforms were found to carry out distinct and specific functions (PMID: 14559777, 12542521, 18541706). In 1996, a number of groups reported that patients suffering from epidermolysis bullosa simplex with muscular dystrophy (EBS-MD) lacked plectin expression in skin and muscle tissues due to defects in the plectin gene (PMID: 8698233, 8941634, 8636409, 8894687, 8696340). Two other subtypes of plectin-related EBS have been described: EBS-pyloric atresia (PA) and EBS-Ogna. For reviews of plectin-related diseases see PMID: 15810881, 19945614. Mutations in the plectin gene related to human diseases should be named based on the position in NM_000445 (human variant 1, isoform 1c), unless the mutation is located within one of the other alternative first exons, in which case the position in the respective Reference Sequence should be used. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted mutations of this gene result in neonatal death, skin blistering, impaired myofibril integrity, reduced hemidesmosome number, and disintegration of intercalated disks in the heart. Mice lacking isoform 1 are viable with no skin blistering but leukocyte recruitment to wounds is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,376,443 I318N probably damaging Het
Abl1 A G 2: 31,800,505 K679E probably benign Het
Actr8 A G 14: 29,989,757 H420R possibly damaging Het
Arhgap29 T A 3: 122,011,453 V897D probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bicc1 A G 10: 70,946,803 probably null Het
Brd4 T C 17: 32,213,639 probably benign Het
Camk2g T C 14: 20,765,446 E184G probably damaging Het
Camta1 T C 4: 151,084,575 S240G possibly damaging Het
Cbx7 C A 15: 79,918,357 A240S probably damaging Het
Ccdc181 A T 1: 164,280,027 D93V probably damaging Het
Ces2g A C 8: 104,962,502 S37R probably benign Het
Clca1 T A 3: 145,008,985 R624W probably damaging Het
Clca3b T C 3: 144,825,935 K703E probably benign Het
Clec2h T C 6: 128,675,882 V204A probably benign Het
Cltb T C 13: 54,599,154 N3S possibly damaging Het
Col9a1 A G 1: 24,179,501 I65V unknown Het
D430041D05Rik C T 2: 104,156,816 R1895Q probably damaging Het
Dnah1 T C 14: 31,299,974 S1191G probably benign Het
Ehf G A 2: 103,274,075 P163S probably benign Het
Fam170b A C 14: 32,835,868 H220P probably damaging Het
Fastkd1 G A 2: 69,696,953 T598I probably benign Het
Fignl2 C T 15: 101,054,035 G122D probably damaging Het
Foxp4 C A 17: 47,871,276 V530L unknown Het
Gcnt1 G T 19: 17,329,331 D343E possibly damaging Het
Gja8 T G 3: 96,920,302 N15H probably benign Het
Gm128 T C 3: 95,240,932 E17G probably benign Het
Gm13212 C T 4: 145,585,321 probably benign Het
Gnl1 T C 17: 35,982,679 V252A probably benign Het
Gpld1 G A 13: 24,982,507 probably null Het
Gpr179 A G 11: 97,351,733 L95P probably damaging Het
Gtf2a1 A T 12: 91,586,739 D31E possibly damaging Het
Il12a T A 3: 68,694,184 Y58* probably null Het
Il1r2 T C 1: 40,105,470 W106R probably damaging Het
Kif26b A G 1: 178,715,923 S374G probably benign Het
Mafb A T 2: 160,366,027 V217E probably damaging Het
Mapk13 T A 17: 28,778,111 D292E probably damaging Het
Matn2 A G 15: 34,433,063 D871G probably damaging Het
Mdn1 C A 4: 32,765,701 T5220K possibly damaging Het
Mfsd6 T C 1: 52,660,819 I723M probably damaging Het
Mfsd7a A G 5: 108,444,707 S234P probably benign Het
Mia2 G A 12: 59,107,882 S127N probably benign Het
Mpeg1 A C 19: 12,463,038 E620A probably damaging Het
Mrgprb3 A T 7: 48,643,641 F54Y probably damaging Het
Mtx2 A G 2: 74,869,352 I156V probably benign Het
Neurog1 T C 13: 56,251,535 E133G probably damaging Het
Nid2 G A 14: 19,805,914 D1236N probably damaging Het
Nif3l1 A G 1: 58,452,129 T213A probably benign Het
Olfr866 A G 9: 20,027,144 S265P probably damaging Het
Otog A G 7: 46,241,029 M1V probably null Het
Pde4dip C T 3: 97,724,164 R1143K probably benign Het
Pgam2 T C 11: 5,803,265 probably benign Het
Pramel5 C A 4: 144,272,936 E194* probably null Het
Prss22 T A 17: 23,996,781 S56C probably damaging Het
Rab23 A G 1: 33,739,325 N216S probably benign Het
Rasgrf1 A T 9: 89,976,762 E491V probably damaging Het
Rbbp8 C T 18: 11,677,669 T76I probably damaging Het
Rtn2 G A 7: 19,286,829 probably null Het
Sdr39u1 A T 14: 55,899,667 N62K probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc26a3 T C 12: 31,457,072 V342A probably damaging Het
Snx30 G T 4: 59,886,515 C308F probably damaging Het
Timd2 A T 11: 46,678,216 V205E probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tnfaip6 G A 2: 52,050,914 D156N probably benign Het
Uggt2 T A 14: 118,995,049 E1463D probably damaging Het
Urb2 C A 8: 124,030,139 P862T probably benign Het
Vmn1r64 A T 7: 5,884,370 L58* probably null Het
Vmn2r3 C A 3: 64,259,062 G883C probably benign Het
Vps13d A T 4: 145,110,895 C2707S possibly damaging Het
Wdr11 G T 7: 129,605,694 probably null Het
Wdr37 T A 13: 8,861,232 probably benign Het
Wtap G A 17: 12,975,465 Q95* probably null Het
Zfp26 A T 9: 20,437,267 L667H probably damaging Het
Other mutations in Plec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Plec APN 15 76172937 missense probably damaging 1.00
IGL01375:Plec APN 15 76176440 missense probably damaging 1.00
IGL01432:Plec APN 15 76190528 missense probably damaging 1.00
IGL01444:Plec APN 15 76179297 missense possibly damaging 0.46
IGL01548:Plec APN 15 76189258 missense probably benign 0.00
IGL01750:Plec APN 15 76173389 missense probably damaging 1.00
IGL01828:Plec APN 15 76183755 missense probably damaging 1.00
IGL01940:Plec APN 15 76180329 missense probably damaging 1.00
IGL02049:Plec APN 15 76178949 missense probably damaging 1.00
IGL02052:Plec APN 15 76180341 missense probably damaging 1.00
IGL02114:Plec APN 15 76173548 missense probably damaging 1.00
IGL02141:Plec APN 15 76175615 missense probably damaging 1.00
IGL02162:Plec APN 15 76180160 missense probably benign 0.01
IGL02227:Plec APN 15 76172274 missense probably damaging 1.00
IGL02449:Plec APN 15 76186763 missense possibly damaging 0.93
IGL02450:Plec APN 15 76191315 missense probably damaging 1.00
IGL02454:Plec APN 15 76191031 missense probably damaging 0.96
IGL02488:Plec APN 15 76179159 missense possibly damaging 0.92
IGL02490:Plec APN 15 76189263 missense probably damaging 1.00
IGL02494:Plec APN 15 76176779 missense probably damaging 1.00
IGL02869:Plec APN 15 76181316 missense probably damaging 1.00
IGL02900:Plec APN 15 76186214 missense probably damaging 1.00
IGL03059:Plec APN 15 76175768 missense probably damaging 1.00
IGL03091:Plec APN 15 76189303 missense possibly damaging 0.58
IGL03094:Plec APN 15 76191319 missense probably damaging 1.00
R0013:Plec UTSW 15 76178246 missense probably damaging 0.96
R0076:Plec UTSW 15 76191414 splice site probably benign
R0092:Plec UTSW 15 76183743 missense probably benign 0.05
R0106:Plec UTSW 15 76176318 missense probably damaging 1.00
R0111:Plec UTSW 15 76178646 missense probably damaging 1.00
R0212:Plec UTSW 15 76191305 nonsense probably null
R0329:Plec UTSW 15 76191418 critical splice donor site probably null
R0330:Plec UTSW 15 76191418 critical splice donor site probably null
R0334:Plec UTSW 15 76178006 missense probably damaging 0.99
R0345:Plec UTSW 15 76177167 missense probably damaging 1.00
R0457:Plec UTSW 15 76177601 missense probably damaging 1.00
R0507:Plec UTSW 15 76172783 missense probably damaging 1.00
R0531:Plec UTSW 15 76177298 missense probably benign 0.11
R0578:Plec UTSW 15 76176884 missense probably damaging 1.00
R0594:Plec UTSW 15 76172253 missense probably damaging 1.00
R0632:Plec UTSW 15 76173411 missense probably damaging 1.00
R0670:Plec UTSW 15 76205960 missense probably damaging 0.99
R0742:Plec UTSW 15 76172783 missense probably damaging 1.00
R0833:Plec UTSW 15 76181907 unclassified probably benign
R0836:Plec UTSW 15 76181907 unclassified probably benign
R0863:Plec UTSW 15 76174080 nonsense probably null
R0948:Plec UTSW 15 76205687 missense probably benign
R1163:Plec UTSW 15 76183838 missense possibly damaging 0.90
R1437:Plec UTSW 15 76189281 missense probably damaging 0.99
R1466:Plec UTSW 15 76185908 missense possibly damaging 0.88
R1466:Plec UTSW 15 76185908 missense possibly damaging 0.88
R1518:Plec UTSW 15 76188201 missense probably damaging 0.99
R1584:Plec UTSW 15 76185908 missense possibly damaging 0.88
R1649:Plec UTSW 15 76205811 missense possibly damaging 0.50
R1728:Plec UTSW 15 76177692 nonsense probably null
R1729:Plec UTSW 15 76177692 nonsense probably null
R1734:Plec UTSW 15 76186218 missense probably damaging 0.99
R1736:Plec UTSW 15 76186218 missense probably damaging 0.99
R1738:Plec UTSW 15 76186218 missense probably damaging 0.99
R1744:Plec UTSW 15 76186218 missense probably damaging 0.99
R1819:Plec UTSW 15 76179906 missense probably damaging 1.00
R1850:Plec UTSW 15 76188232 missense probably benign 0.39
R1901:Plec UTSW 15 76175551 missense probably damaging 0.98
R1902:Plec UTSW 15 76175551 missense probably damaging 0.98
R1969:Plec UTSW 15 76189172 missense probably damaging 1.00
R1991:Plec UTSW 15 76173543 missense probably damaging 1.00
R2049:Plec UTSW 15 76183174 missense probably benign 0.39
R2069:Plec UTSW 15 76188926 missense probably benign 0.10
R2103:Plec UTSW 15 76173543 missense probably damaging 1.00
R2140:Plec UTSW 15 76183174 missense probably benign 0.39
R2142:Plec UTSW 15 76183174 missense probably benign 0.39
R2234:Plec UTSW 15 76176947 missense probably damaging 1.00
R2762:Plec UTSW 15 76172286 missense probably damaging 1.00
R2924:Plec UTSW 15 76178252 missense probably damaging 1.00
R2925:Plec UTSW 15 76178252 missense probably damaging 1.00
R2973:Plec UTSW 15 76188761 missense probably damaging 1.00
R2974:Plec UTSW 15 76188761 missense probably damaging 1.00
R4125:Plec UTSW 15 76172762 missense probably damaging 1.00
R4156:Plec UTSW 15 76172253 missense probably damaging 1.00
R4161:Plec UTSW 15 76179651 missense possibly damaging 0.92
R4179:Plec UTSW 15 76180215 missense possibly damaging 0.76
R4180:Plec UTSW 15 76180215 missense possibly damaging 0.76
R4222:Plec UTSW 15 76177319 missense probably damaging 1.00
R4373:Plec UTSW 15 76183117 missense probably damaging 0.99
R4513:Plec UTSW 15 76186218 missense probably damaging 0.99
R4546:Plec UTSW 15 76181557 missense probably benign 0.07
R4577:Plec UTSW 15 76184069 missense possibly damaging 0.55
R4584:Plec UTSW 15 76231206 missense possibly damaging 0.89
R4619:Plec UTSW 15 76192182 missense probably benign 0.00
R4624:Plec UTSW 15 76175135 missense probably damaging 1.00
R4680:Plec UTSW 15 76180575 missense unknown
R4690:Plec UTSW 15 76174256 missense probably damaging 1.00
R4713:Plec UTSW 15 76181067 missense unknown
R4927:Plec UTSW 15 76176962 missense probably damaging 1.00
R4980:Plec UTSW 15 76193295 nonsense probably null
R4980:Plec UTSW 15 76205865 missense probably damaging 0.97
R5141:Plec UTSW 15 76190533 missense probably damaging 1.00
R5191:Plec UTSW 15 76175165 missense probably damaging 1.00
R5214:Plec UTSW 15 76177721 missense probably damaging 1.00
R5260:Plec UTSW 15 76176624 missense probably damaging 1.00
R5276:Plec UTSW 15 76173438 missense probably damaging 1.00
R5291:Plec UTSW 15 76174011 missense probably damaging 1.00
R5293:Plec UTSW 15 76199583 missense probably benign
R5498:Plec UTSW 15 76177454 missense probably damaging 1.00
R5617:Plec UTSW 15 76174532 missense probably damaging 1.00
R5668:Plec UTSW 15 76190466 missense possibly damaging 0.71
R5684:Plec UTSW 15 76205596 critical splice donor site probably null
R5698:Plec UTSW 15 76199608 missense probably benign 0.06
R5707:Plec UTSW 15 76199671 intron probably benign
R5753:Plec UTSW 15 76173420 missense probably damaging 1.00
R5762:Plec UTSW 15 76179255 missense probably damaging 1.00
R5976:Plec UTSW 15 76189037 missense probably damaging 1.00
R5995:Plec UTSW 15 76185905 missense probably damaging 1.00
R6013:Plec UTSW 15 76189310 missense possibly damaging 0.65
R6050:Plec UTSW 15 76188258 missense probably damaging 1.00
R6172:Plec UTSW 15 76172376 missense probably damaging 0.99
R6272:Plec UTSW 15 76174853 missense probably damaging 1.00
R6375:Plec UTSW 15 76177640 missense probably damaging 1.00
R6466:Plec UTSW 15 76177884 missense probably benign 0.03
R6528:Plec UTSW 15 76174430 missense probably damaging 1.00
R6586:Plec UTSW 15 76175087 missense probably damaging 1.00
R6652:Plec UTSW 15 76179774 missense probably damaging 0.97
R6657:Plec UTSW 15 76178156 missense possibly damaging 0.74
R6679:Plec UTSW 15 76173815 missense probably damaging 1.00
R6734:Plec UTSW 15 76194403 missense probably damaging 1.00
R6795:Plec UTSW 15 76180138 missense probably damaging 1.00
R6855:Plec UTSW 15 76186618 missense probably damaging 0.99
R6908:Plec UTSW 15 76185881 nonsense probably null
R6957:Plec UTSW 15 76186214 missense probably damaging 1.00
R6984:Plec UTSW 15 76175327 missense probably damaging 1.00
R7017:Plec UTSW 15 76173541 missense probably damaging 1.00
R7043:Plec UTSW 15 76209128 unclassified probably benign
R7068:Plec UTSW 15 76177769 missense probably damaging 1.00
R7133:Plec UTSW 15 76176027 missense possibly damaging 0.95
R7183:Plec UTSW 15 76205705 missense unknown
R7221:Plec UTSW 15 76175774 missense probably damaging 0.97
R7247:Plec UTSW 15 76177343 missense probably damaging 1.00
R7272:Plec UTSW 15 76174953 missense possibly damaging 0.84
R7346:Plec UTSW 15 76197978 critical splice donor site probably null
R7375:Plec UTSW 15 76177355 missense possibly damaging 0.89
R7396:Plec UTSW 15 76174889 missense probably damaging 1.00
R7505:Plec UTSW 15 76181194 missense unknown
R7530:Plec UTSW 15 76185644 missense unknown
R7576:Plec UTSW 15 76187746 missense unknown
R7585:Plec UTSW 15 76173432 missense probably damaging 1.00
R7627:Plec UTSW 15 76177394 missense probably damaging 1.00
R7695:Plec UTSW 15 76183855 nonsense probably null
R7697:Plec UTSW 15 76181685 missense unknown
R7718:Plec UTSW 15 76177439 missense probably damaging 1.00
R7762:Plec UTSW 15 76183623 missense unknown
R7775:Plec UTSW 15 76176935 missense probably damaging 1.00
R7778:Plec UTSW 15 76176935 missense probably damaging 1.00
R7785:Plec UTSW 15 76205829 missense unknown
R7787:Plec UTSW 15 76199611 missense unknown
U24488:Plec UTSW 15 76177730 missense probably benign 0.15
X0028:Plec UTSW 15 76173235 missense probably damaging 1.00
X0061:Plec UTSW 15 76174899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGGTGTAAGTACTGGC -3'
(R):5'- TTGTGCTTAGAACCGGAGC -3'

Sequencing Primer
(F):5'- CGTAGGTGGTCAATGCCCTC -3'
(R):5'- TTAGAACCGGAGCCTGCCTG -3'
Posted On2014-10-15