Incidental Mutation 'R2235:Slc4a11'
ID240373
Institutional Source Beutler Lab
Gene Symbol Slc4a11
Ensembl Gene ENSMUSG00000074796
Gene Namesolute carrier family 4, sodium bicarbonate transporter-like, member 11
Synonyms
MMRRC Submission 040236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R2235 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130684113-130697519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130685624 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 617 (E617G)
Ref Sequence ENSEMBL: ENSMUSP00000096963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099362] [ENSMUST00000103193]
Predicted Effect probably benign
Transcript: ENSMUST00000099362
AA Change: E617G

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096963
Gene: ENSMUSG00000074796
AA Change: E617G

DomainStartEndE-ValueType
SCOP:d1a3aa_ 199 276 5e-5 SMART
Pfam:HCO3_cotransp 308 806 9.7e-153 PFAM
transmembrane domain 827 844 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103193
SMART Domains Protein: ENSMUSP00000099482
Gene: ENSMUSG00000074797

DomainStartEndE-ValueType
Pfam:Ham1p_like 10 188 4.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144945
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-regulated, electrogenic sodium-coupled borate cotransporter that is essential for borate homeostasis, cell growth and cell proliferation. Mutations in this gene have been associated with a number of endothelial corneal dystrophies including recessive corneal endothelial dystrophy 2, corneal dystrophy and perceptive deafness, and Fuchs endothelial corneal dystrophy. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele show a collapsed vestibular labyrinth, reduced brainstem auditory potentials, and altered corneal epithelium. Mice homozygous for a reporter allele show corneal endothelial dystrophy, polyuria, natriuresis, urinehypoosmolarity and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,642,064 V256A probably benign Het
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adcy2 A T 13: 68,668,492 Y792N probably damaging Het
Alpk1 T C 3: 127,680,920 K478R probably benign Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Bach1 A G 16: 87,720,113 D514G probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cldn34b3 A T X: 76,267,224 I133F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Cts6 T A 13: 61,195,433 I325F probably damaging Het
Dnah6 T C 6: 73,100,085 D2347G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Fam160a1 A T 3: 85,661,101 L1037Q probably damaging Het
Fndc11 A G 2: 181,222,274 S291G possibly damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Ly6h A G 15: 75,565,189 S113P probably benign Het
Mto1 A C 9: 78,457,564 T362P possibly damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr518 A G 7: 108,880,965 F214L probably benign Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Pld3 G A 7: 27,541,107 T136M probably benign Het
Prph2 A T 17: 46,911,166 D157V probably damaging Het
Racgap1 A G 15: 99,626,536 S357P probably benign Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Smap1 T C 1: 23,859,058 N99S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Sox4 C T 13: 28,952,630 R131Q probably damaging Het
Spaca6 T C 17: 17,838,245 probably null Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tpr T A 1: 150,442,092 F2117Y probably benign Het
Traf5 T C 1: 192,054,391 M125V probably damaging Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Ubp1 T G 9: 113,964,644 S340R probably damaging Het
Vit T C 17: 78,605,438 S267P probably benign Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Zfp990 T A 4: 145,537,891 H486Q probably damaging Het
Zkscan6 T C 11: 65,828,272 S373P probably benign Het
Other mutations in Slc4a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Slc4a11 APN 2 130688138 missense probably benign 0.11
IGL01292:Slc4a11 APN 2 130690832 critical splice donor site probably null
IGL01330:Slc4a11 APN 2 130687682 missense probably benign 0.11
IGL01349:Slc4a11 APN 2 130686943 missense probably benign 0.33
IGL01474:Slc4a11 APN 2 130685544 missense probably damaging 1.00
IGL01528:Slc4a11 APN 2 130685408 unclassified probably benign
IGL01752:Slc4a11 APN 2 130688145 missense probably damaging 1.00
IGL01859:Slc4a11 APN 2 130684994 missense probably damaging 1.00
IGL01914:Slc4a11 APN 2 130687279 missense probably damaging 1.00
IGL02367:Slc4a11 APN 2 130684959 missense probably damaging 1.00
IGL02373:Slc4a11 APN 2 130684898 missense probably benign 0.07
IGL02516:Slc4a11 APN 2 130691393 missense possibly damaging 0.89
IGL02894:Slc4a11 APN 2 130687155 splice site probably null
R0029:Slc4a11 UTSW 2 130688054 missense probably damaging 1.00
R0077:Slc4a11 UTSW 2 130686301 unclassified probably benign
R0270:Slc4a11 UTSW 2 130690932 missense possibly damaging 0.89
R0502:Slc4a11 UTSW 2 130688157 missense probably damaging 1.00
R1316:Slc4a11 UTSW 2 130686151 missense probably benign 0.01
R1628:Slc4a11 UTSW 2 130687127 intron probably null
R1859:Slc4a11 UTSW 2 130688012 missense probably benign 0.00
R2247:Slc4a11 UTSW 2 130687801 missense probably benign 0.00
R2332:Slc4a11 UTSW 2 130684459 missense probably benign 0.17
R3840:Slc4a11 UTSW 2 130688054 missense probably damaging 1.00
R3890:Slc4a11 UTSW 2 130685785 missense probably damaging 0.98
R4296:Slc4a11 UTSW 2 130685007 missense probably benign 0.01
R4304:Slc4a11 UTSW 2 130688138 missense probably benign 0.11
R4749:Slc4a11 UTSW 2 130690867 missense probably damaging 1.00
R4927:Slc4a11 UTSW 2 130684946 missense probably damaging 0.99
R4939:Slc4a11 UTSW 2 130684868 missense probably damaging 1.00
R5756:Slc4a11 UTSW 2 130687863 missense probably benign 0.13
R5869:Slc4a11 UTSW 2 130684459 missense probably benign 0.04
R5905:Slc4a11 UTSW 2 130685052 missense probably damaging 1.00
R6709:Slc4a11 UTSW 2 130684696 missense probably damaging 1.00
R7337:Slc4a11 UTSW 2 130685532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCCCAGTGATAGGCAGTG -3'
(R):5'- TGAGACCCTGTCTGACTGTG -3'

Sequencing Primer
(F):5'- TTGACTGTCAGAAGTCTGGAACC -3'
(R):5'- GTCTGACTGTGCCCTGC -3'
Posted On2014-10-15