Incidental Mutation 'R2235:Zfp990'
ID240382
Institutional Source Beutler Lab
Gene Symbol Zfp990
Ensembl Gene ENSMUSG00000078503
Gene Namezinc finger protein 990
SynonymsGm13225
MMRRC Submission 040236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2235 (G1)
Quality Score128
Status Not validated
Chromosome4
Chromosomal Location145510759-145539188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145537891 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 486 (H486Q)
Ref Sequence ENSEMBL: ENSMUSP00000101368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105741] [ENSMUST00000105742] [ENSMUST00000136309]
Predicted Effect probably damaging
Transcript: ENSMUST00000105741
AA Change: H486Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101367
Gene: ENSMUSG00000078503
AA Change: H486Q

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105742
AA Change: H486Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101368
Gene: ENSMUSG00000078503
AA Change: H486Q

DomainStartEndE-ValueType
KRAB 13 76 1.34e-15 SMART
ZnF_C2H2 240 262 2.24e-3 SMART
ZnF_C2H2 268 290 3.58e-2 SMART
ZnF_C2H2 296 318 8.34e-3 SMART
ZnF_C2H2 324 346 1.22e-4 SMART
ZnF_C2H2 352 374 1.4e-4 SMART
ZnF_C2H2 380 402 9.73e-4 SMART
ZnF_C2H2 408 430 1.6e-4 SMART
ZnF_C2H2 436 458 1.92e-2 SMART
ZnF_C2H2 464 486 1.4e-4 SMART
ZnF_C2H2 492 514 9.73e-4 SMART
ZnF_C2H2 520 542 1.84e-4 SMART
ZnF_C2H2 548 570 4.47e-3 SMART
ZnF_C2H2 576 598 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136309
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,642,064 V256A probably benign Het
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adcy2 A T 13: 68,668,492 Y792N probably damaging Het
Alpk1 T C 3: 127,680,920 K478R probably benign Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Bach1 A G 16: 87,720,113 D514G probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cldn34b3 A T X: 76,267,224 I133F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Cts6 T A 13: 61,195,433 I325F probably damaging Het
Dnah6 T C 6: 73,100,085 D2347G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Fam160a1 A T 3: 85,661,101 L1037Q probably damaging Het
Fndc11 A G 2: 181,222,274 S291G possibly damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Ly6h A G 15: 75,565,189 S113P probably benign Het
Mto1 A C 9: 78,457,564 T362P possibly damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr518 A G 7: 108,880,965 F214L probably benign Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Pld3 G A 7: 27,541,107 T136M probably benign Het
Prph2 A T 17: 46,911,166 D157V probably damaging Het
Racgap1 A G 15: 99,626,536 S357P probably benign Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc4a11 T C 2: 130,685,624 E617G probably benign Het
Smap1 T C 1: 23,859,058 N99S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Sox4 C T 13: 28,952,630 R131Q probably damaging Het
Spaca6 T C 17: 17,838,245 probably null Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tpr T A 1: 150,442,092 F2117Y probably benign Het
Traf5 T C 1: 192,054,391 M125V probably damaging Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Ubp1 T G 9: 113,964,644 S340R probably damaging Het
Vit T C 17: 78,605,438 S267P probably benign Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Zkscan6 T C 11: 65,828,272 S373P probably benign Het
Other mutations in Zfp990
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Zfp990 APN 4 145537868 missense probably damaging 0.99
IGL01774:Zfp990 APN 4 145536948 missense probably benign 0.28
IGL01895:Zfp990 APN 4 145536857 missense probably damaging 0.97
IGL01895:Zfp990 APN 4 145536858 missense probably damaging 0.99
IGL02349:Zfp990 APN 4 145530877 utr 5 prime probably benign
IGL02598:Zfp990 APN 4 145536963 missense possibly damaging 0.67
IGL02940:Zfp990 APN 4 145534922 splice site probably null
IGL03026:Zfp990 APN 4 145537110 missense possibly damaging 0.54
R0007:Zfp990 UTSW 4 145537438 missense probably benign 0.00
R0352:Zfp990 UTSW 4 145536604 missense probably damaging 0.99
R0631:Zfp990 UTSW 4 145537302 missense possibly damaging 0.89
R1490:Zfp990 UTSW 4 145537283 missense probably benign 0.44
R1537:Zfp990 UTSW 4 145536996 missense possibly damaging 0.67
R1832:Zfp990 UTSW 4 145538210 missense possibly damaging 0.51
R1956:Zfp990 UTSW 4 145534882 missense probably damaging 1.00
R1982:Zfp990 UTSW 4 145536869 missense probably damaging 0.99
R2024:Zfp990 UTSW 4 145537404 missense possibly damaging 0.69
R2097:Zfp990 UTSW 4 145537322 missense possibly damaging 0.94
R4194:Zfp990 UTSW 4 145536977 splice site probably null
R4195:Zfp990 UTSW 4 145536977 splice site probably null
R4418:Zfp990 UTSW 4 145536728 missense possibly damaging 0.87
R4617:Zfp990 UTSW 4 145537046 missense possibly damaging 0.59
R4736:Zfp990 UTSW 4 145536942 missense possibly damaging 0.95
R4880:Zfp990 UTSW 4 145537920 missense probably benign
R4941:Zfp990 UTSW 4 145536837 missense probably damaging 1.00
R5014:Zfp990 UTSW 4 145538099 missense possibly damaging 0.93
R5945:Zfp990 UTSW 4 145538043 missense probably damaging 0.98
R6238:Zfp990 UTSW 4 145537913 missense probably damaging 1.00
R6255:Zfp990 UTSW 4 145537789 missense probably benign 0.00
R6267:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6296:Zfp990 UTSW 4 145538103 missense possibly damaging 0.59
R6412:Zfp990 UTSW 4 145537568 missense probably benign 0.00
R6616:Zfp990 UTSW 4 145537145 missense probably benign 0.01
R6701:Zfp990 UTSW 4 145538178 missense probably benign 0.45
R6720:Zfp990 UTSW 4 145536927 missense possibly damaging 0.67
R7015:Zfp990 UTSW 4 145536635 missense probably damaging 0.99
R7487:Zfp990 UTSW 4 145537587 missense probably damaging 1.00
R7722:Zfp990 UTSW 4 145536962 missense possibly damaging 0.86
Z1176:Zfp990 UTSW 4 145536811 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGCAGTGAATGTGACAAATGCT -3'
(R):5'- CATTCACTACATTTGTGAGGTTTCT -3'

Sequencing Primer
(F):5'- CCTTACAAATGCAGTGGATGTGAC -3'
(R):5'- AAGGTTTCTCTCCTGTGTG -3'
Posted On2014-10-15