Incidental Mutation 'R2235:Racgap1'
ID240413
Institutional Source Beutler Lab
Gene Symbol Racgap1
Ensembl Gene ENSMUSG00000023015
Gene NameRac GTPase-activating protein 1
SynonymsBand25, gtl11, GTPase, MgcRacGAP
MMRRC Submission 040236-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2235 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99620496-99651656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99626536 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 357 (S357P)
Ref Sequence ENSEMBL: ENSMUSP00000126417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023756] [ENSMUST00000168065] [ENSMUST00000171702]
Predicted Effect probably benign
Transcript: ENSMUST00000023756
AA Change: S357P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023756
Gene: ENSMUSG00000023015
AA Change: S357P

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165745
Predicted Effect probably benign
Transcript: ENSMUST00000168065
SMART Domains Protein: ENSMUSP00000132732
Gene: ENSMUSG00000023015

DomainStartEndE-ValueType
coiled coil region 6 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171017
Predicted Effect probably benign
Transcript: ENSMUST00000171702
AA Change: S357P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126417
Gene: ENSMUSG00000023015
AA Change: S357P

DomainStartEndE-ValueType
coiled coil region 35 110 N/A INTRINSIC
C1 288 336 2.44e-5 SMART
RhoGAP 361 537 3.4e-51 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a compoment of the centralspindlin complex. This protein binds activated forms of Rho GTPases and stimulates GTP hydrolysis, which results in negative regulation of Rho-mediated signals. This protein plays a regulatory role in cytokinesis, cell growth, and differentiation. Alternatively spliced transcript variants have been found for this gene. There is a pseudogene for this gene on chromosome 12. [provided by RefSeq, Feb 2016]
PHENOTYPE: Embryos homozygous for a gene-trapped allele exhibit pre-implantation lethality associated with the formation of multinucleated blastomeres and failure to complete cytokinesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,642,064 V256A probably benign Het
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adcy2 A T 13: 68,668,492 Y792N probably damaging Het
Alpk1 T C 3: 127,680,920 K478R probably benign Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Bach1 A G 16: 87,720,113 D514G probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cldn34b3 A T X: 76,267,224 I133F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Cts6 T A 13: 61,195,433 I325F probably damaging Het
Dnah6 T C 6: 73,100,085 D2347G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Fam160a1 A T 3: 85,661,101 L1037Q probably damaging Het
Fndc11 A G 2: 181,222,274 S291G possibly damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Ly6h A G 15: 75,565,189 S113P probably benign Het
Mto1 A C 9: 78,457,564 T362P possibly damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr518 A G 7: 108,880,965 F214L probably benign Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Pld3 G A 7: 27,541,107 T136M probably benign Het
Prph2 A T 17: 46,911,166 D157V probably damaging Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc4a11 T C 2: 130,685,624 E617G probably benign Het
Smap1 T C 1: 23,859,058 N99S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Sox4 C T 13: 28,952,630 R131Q probably damaging Het
Spaca6 T C 17: 17,838,245 probably null Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tpr T A 1: 150,442,092 F2117Y probably benign Het
Traf5 T C 1: 192,054,391 M125V probably damaging Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Ubp1 T G 9: 113,964,644 S340R probably damaging Het
Vit T C 17: 78,605,438 S267P probably benign Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Zfp990 T A 4: 145,537,891 H486Q probably damaging Het
Zkscan6 T C 11: 65,828,272 S373P probably benign Het
Other mutations in Racgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Racgap1 APN 15 99636122 unclassified probably benign
IGL01450:Racgap1 APN 15 99626363 missense probably benign 0.00
IGL01907:Racgap1 APN 15 99626333 nonsense probably null
IGL02584:Racgap1 APN 15 99623634 missense probably benign 0.00
IGL02733:Racgap1 APN 15 99639704 missense probably damaging 1.00
IGL03137:Racgap1 APN 15 99628741 missense probably damaging 0.96
IGL03145:Racgap1 APN 15 99623640 missense probably benign 0.00
IGL02799:Racgap1 UTSW 15 99632747 missense probably benign 0.09
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0106:Racgap1 UTSW 15 99642958 missense possibly damaging 0.66
R0140:Racgap1 UTSW 15 99623651 missense probably benign 0.00
R0398:Racgap1 UTSW 15 99628627 splice site probably benign
R0496:Racgap1 UTSW 15 99639832 splice site probably benign
R0528:Racgap1 UTSW 15 99628706 missense probably damaging 1.00
R0893:Racgap1 UTSW 15 99626530 missense probably benign
R0947:Racgap1 UTSW 15 99624314 missense possibly damaging 0.83
R1348:Racgap1 UTSW 15 99626365 missense possibly damaging 0.54
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1470:Racgap1 UTSW 15 99639775 missense probably damaging 0.99
R1720:Racgap1 UTSW 15 99628769 nonsense probably null
R3624:Racgap1 UTSW 15 99642891 missense probably damaging 0.97
R4621:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4622:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R4623:Racgap1 UTSW 15 99626206 missense probably benign 0.10
R5046:Racgap1 UTSW 15 99628762 missense probably damaging 1.00
R5899:Racgap1 UTSW 15 99623628 missense possibly damaging 0.80
R6306:Racgap1 UTSW 15 99623953 missense probably benign
R6513:Racgap1 UTSW 15 99624275 missense probably damaging 1.00
R6618:Racgap1 UTSW 15 99623994 missense probably damaging 0.97
R6953:Racgap1 UTSW 15 99626329 missense probably damaging 1.00
R7359:Racgap1 UTSW 15 99631200 missense probably benign
R7463:Racgap1 UTSW 15 99642958 missense probably benign
R8292:Racgap1 UTSW 15 99622246 nonsense probably null
R8883:Racgap1 UTSW 15 99628659 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGATCCTGTACAAGCCTGC -3'
(R):5'- TGCTCATGTCAGGCCTTGAG -3'

Sequencing Primer
(F):5'- GCCTGCCTGTTATAGAGATGACAC -3'
(R):5'- ATACACAGGAGTTTAGGTGCCTC -3'
Posted On2014-10-15