Incidental Mutation 'R2235:Vmn2r124'
ID240417
Institutional Source Beutler Lab
Gene Symbol Vmn2r124
Ensembl Gene ENSMUSG00000094396
Gene Namevomeronasal 2, receptor 124
SynonymsGm7196, Vmn2r-ps113
MMRRC Submission 040236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2235 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18049424-18079732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18049665 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 61 (H61L)
Ref Sequence ENSEMBL: ENSMUSP00000155888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176802] [ENSMUST00000231546]
Predicted Effect probably benign
Transcript: ENSMUST00000176802
AA Change: H61L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135613
Gene: ENSMUSG00000094396
AA Change: H61L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 84 449 2.2e-37 PFAM
Pfam:NCD3G 510 563 9.3e-21 PFAM
Pfam:7tm_3 596 831 1.6e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000231546
AA Change: H61L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,642,064 V256A probably benign Het
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adcy2 A T 13: 68,668,492 Y792N probably damaging Het
Alpk1 T C 3: 127,680,920 K478R probably benign Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Bach1 A G 16: 87,720,113 D514G probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cldn34b3 A T X: 76,267,224 I133F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Cts6 T A 13: 61,195,433 I325F probably damaging Het
Dnah6 T C 6: 73,100,085 D2347G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Fam160a1 A T 3: 85,661,101 L1037Q probably damaging Het
Fndc11 A G 2: 181,222,274 S291G possibly damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Ly6h A G 15: 75,565,189 S113P probably benign Het
Mto1 A C 9: 78,457,564 T362P possibly damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr518 A G 7: 108,880,965 F214L probably benign Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Pld3 G A 7: 27,541,107 T136M probably benign Het
Prph2 A T 17: 46,911,166 D157V probably damaging Het
Racgap1 A G 15: 99,626,536 S357P probably benign Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc4a11 T C 2: 130,685,624 E617G probably benign Het
Smap1 T C 1: 23,859,058 N99S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Sox4 C T 13: 28,952,630 R131Q probably damaging Het
Spaca6 T C 17: 17,838,245 probably null Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tpr T A 1: 150,442,092 F2117Y probably benign Het
Traf5 T C 1: 192,054,391 M125V probably damaging Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Ubp1 T G 9: 113,964,644 S340R probably damaging Het
Vit T C 17: 78,605,438 S267P probably benign Het
Zfp990 T A 4: 145,537,891 H486Q probably damaging Het
Zkscan6 T C 11: 65,828,272 S373P probably benign Het
Other mutations in Vmn2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Vmn2r124 APN 17 18062670 missense probably benign 0.04
IGL01356:Vmn2r124 APN 17 18073471 missense probably benign 0.08
IGL01387:Vmn2r124 APN 17 18062926 missense probably damaging 0.98
IGL01413:Vmn2r124 APN 17 18062565 missense probably benign 0.41
IGL01550:Vmn2r124 APN 17 18063355 critical splice donor site probably null
IGL01759:Vmn2r124 APN 17 18064068 missense probably benign 0.00
IGL01762:Vmn2r124 APN 17 18063172 missense possibly damaging 0.51
IGL02132:Vmn2r124 APN 17 18064229 splice site probably benign
IGL02290:Vmn2r124 APN 17 18073335 missense probably benign 0.09
IGL02370:Vmn2r124 APN 17 18064191 missense probably benign 0.14
IGL02527:Vmn2r124 APN 17 18066502 critical splice acceptor site probably null
PIT4280001:Vmn2r124 UTSW 17 18063225 missense probably benign 0.22
PIT4514001:Vmn2r124 UTSW 17 18073712 missense probably benign 0.01
R0362:Vmn2r124 UTSW 17 18064224 critical splice donor site probably null
R0401:Vmn2r124 UTSW 17 18064145 missense probably damaging 0.99
R0513:Vmn2r124 UTSW 17 18073729 missense possibly damaging 0.89
R1139:Vmn2r124 UTSW 17 18073790 missense possibly damaging 0.56
R1513:Vmn2r124 UTSW 17 18063273 missense probably damaging 1.00
R1669:Vmn2r124 UTSW 17 18062944 missense possibly damaging 0.94
R1710:Vmn2r124 UTSW 17 18061925 splice site probably benign
R1852:Vmn2r124 UTSW 17 18063174 missense probably benign
R1860:Vmn2r124 UTSW 17 18049497 missense probably benign 0.11
R1953:Vmn2r124 UTSW 17 18062860 missense probably benign 0.08
R2233:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2234:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2397:Vmn2r124 UTSW 17 18049597 missense possibly damaging 0.95
R2519:Vmn2r124 UTSW 17 18074018 missense probably damaging 1.00
R3845:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R3846:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R4594:Vmn2r124 UTSW 17 18073969 missense probably damaging 1.00
R4612:Vmn2r124 UTSW 17 18063022 missense probably benign 0.12
R4790:Vmn2r124 UTSW 17 18049593 missense probably damaging 1.00
R4809:Vmn2r124 UTSW 17 18073745 missense probably benign 0.00
R5227:Vmn2r124 UTSW 17 18049557 missense possibly damaging 0.95
R5254:Vmn2r124 UTSW 17 18063077 missense probably benign 0.00
R5609:Vmn2r124 UTSW 17 18073840 missense probably benign
R6145:Vmn2r124 UTSW 17 18062851 missense probably benign 0.05
R6181:Vmn2r124 UTSW 17 18073757 missense possibly damaging 0.93
R6271:Vmn2r124 UTSW 17 18062883 missense probably benign 0.01
R7297:Vmn2r124 UTSW 17 18073573 missense probably damaging 1.00
R7397:Vmn2r124 UTSW 17 18062685 missense probably damaging 1.00
R7406:Vmn2r124 UTSW 17 18062044 missense unknown
R7699:Vmn2r124 UTSW 17 18073723 missense probably benign 0.00
R7859:Vmn2r124 UTSW 17 18061950 missense probably damaging 1.00
R8121:Vmn2r124 UTSW 17 18062171 missense probably benign
R8138:Vmn2r124 UTSW 17 18063348 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGACACTGTTCTGCATCAAG -3'
(R):5'- CCCCTGAGGAAAATAATCTAAAAGG -3'

Sequencing Primer
(F):5'- CTGGCTCTTGCAAATTTCC -3'
(R):5'- ATGGCTACACACTCTAAGT -3'
Posted On2014-10-15