Incidental Mutation 'R2235:Vit'
ID240419
Institutional Source Beutler Lab
Gene Symbol Vit
Ensembl Gene ENSMUSG00000024076
Gene Namevitrin
Synonyms
MMRRC Submission 040236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2235 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78508063-78627409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78605438 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 267 (S267P)
Ref Sequence ENSEMBL: ENSMUSP00000024880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024880]
Predicted Effect probably benign
Transcript: ENSMUST00000024880
AA Change: S267P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000024880
Gene: ENSMUSG00000024076
AA Change: S267P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 42 124 2.5e-45 SMART
low complexity region 148 171 N/A INTRINSIC
VWA 263 451 7.34e-39 SMART
VWA 465 641 1.02e-46 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix (ECM) protein. The protein may be associated with cell adhesion and migration. High levels of expression of the protein in specific parts of the brain suggest its likely role in neural development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele show decreased spinal cord size associated with reduced cell proliferation and altered cell differentiation in the central canal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,642,064 V256A probably benign Het
Acbd6 A G 1: 155,558,708 D24G probably damaging Het
Adcy2 A T 13: 68,668,492 Y792N probably damaging Het
Alpk1 T C 3: 127,680,920 K478R probably benign Het
Atad2b T G 12: 5,006,745 F867C probably damaging Het
Bach1 A G 16: 87,720,113 D514G probably damaging Het
BC035947 A T 1: 78,497,962 D644E probably damaging Het
Ccdc129 A T 6: 55,897,812 H249L possibly damaging Het
Chrm4 A G 2: 91,928,530 S428G probably benign Het
Clca1 G T 3: 145,009,068 P596Q possibly damaging Het
Cldn34b3 A T X: 76,267,224 I133F probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Crh A T 3: 19,693,932 M182K probably damaging Het
Csta1 C T 16: 36,125,075 V23I probably damaging Het
Cts6 T A 13: 61,195,433 I325F probably damaging Het
Dnah6 T C 6: 73,100,085 D2347G probably damaging Het
Dync1i2 C T 2: 71,249,420 Q419* probably null Het
E2f4 T A 8: 105,298,651 V121E probably damaging Het
Fam160a1 A T 3: 85,661,101 L1037Q probably damaging Het
Fndc11 A G 2: 181,222,274 S291G possibly damaging Het
Hid1 A G 11: 115,351,119 I555T probably damaging Het
Hyou1 C T 9: 44,389,091 T855M probably benign Het
Igf1r T A 7: 68,212,080 N1129K probably damaging Het
Iglon5 T C 7: 43,480,638 E34G probably damaging Het
Kcnab1 T A 3: 65,319,467 V189D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrrc49 A T 9: 60,598,157 F538L possibly damaging Het
Ly6h A G 15: 75,565,189 S113P probably benign Het
Mto1 A C 9: 78,457,564 T362P possibly damaging Het
Myot A G 18: 44,354,272 D392G probably damaging Het
Olfr1346 T C 7: 6,474,442 S111P possibly damaging Het
Olfr518 A G 7: 108,880,965 F214L probably benign Het
Osbpl6 T C 2: 76,586,769 F577L probably damaging Het
Otc A G X: 10,303,367 Q216R probably benign Het
Pds5a A T 5: 65,654,098 F331I probably damaging Het
Pld3 G A 7: 27,541,107 T136M probably benign Het
Prph2 A T 17: 46,911,166 D157V probably damaging Het
Racgap1 A G 15: 99,626,536 S357P probably benign Het
Ralgapa1 A T 12: 55,717,071 H1403Q probably benign Het
Rnf216 G A 5: 143,090,926 H68Y probably benign Het
Scgb1b27 T C 7: 34,021,824 Y46H probably damaging Het
Sel1l2 T C 2: 140,244,165 Y502C probably damaging Het
Sis A T 3: 72,913,194 F1412L probably benign Het
Slc4a11 T C 2: 130,685,624 E617G probably benign Het
Smap1 T C 1: 23,859,058 N99S probably benign Het
Smg7 A T 1: 152,868,313 Y40N probably damaging Het
Sox4 C T 13: 28,952,630 R131Q probably damaging Het
Spaca6 T C 17: 17,838,245 probably null Het
Tbx18 G T 9: 87,724,350 S247R probably damaging Het
Tenm3 T C 8: 48,276,169 I1601V probably benign Het
Thap4 G T 1: 93,725,212 Q441K probably benign Het
Tmprss11c G T 5: 86,282,086 T40K probably benign Het
Tpr T A 1: 150,442,092 F2117Y probably benign Het
Traf5 T C 1: 192,054,391 M125V probably damaging Het
Trim65 G T 11: 116,130,677 T110K possibly damaging Het
Ubp1 T G 9: 113,964,644 S340R probably damaging Het
Vmn2r124 A T 17: 18,049,665 H61L possibly damaging Het
Zfp990 T A 4: 145,537,891 H486Q probably damaging Het
Zkscan6 T C 11: 65,828,272 S373P probably benign Het
Other mutations in Vit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vit APN 17 78601907 critical splice donor site probably null
IGL00929:Vit APN 17 78579401 missense probably damaging 0.98
IGL01447:Vit APN 17 78625204 missense probably damaging 1.00
IGL02000:Vit APN 17 78605486 missense possibly damaging 0.94
IGL02230:Vit APN 17 78619627 missense probably damaging 1.00
IGL02245:Vit APN 17 78625051 missense probably damaging 1.00
IGL02315:Vit APN 17 78622658 missense possibly damaging 0.80
IGL03133:Vit APN 17 78566071 missense probably benign
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0520:Vit UTSW 17 78625159 missense probably damaging 1.00
R0550:Vit UTSW 17 78624793 missense possibly damaging 0.95
R0565:Vit UTSW 17 78624837 missense probably damaging 1.00
R0856:Vit UTSW 17 78619657 missense possibly damaging 0.53
R1155:Vit UTSW 17 78566027 missense probably damaging 1.00
R1327:Vit UTSW 17 78625200 missense probably damaging 1.00
R1690:Vit UTSW 17 78624865 missense probably damaging 1.00
R1802:Vit UTSW 17 78605511 missense possibly damaging 0.91
R1822:Vit UTSW 17 78622836 missense probably benign 0.01
R1826:Vit UTSW 17 78534676 missense probably benign 0.22
R1827:Vit UTSW 17 78546446 critical splice donor site probably null
R1862:Vit UTSW 17 78622746 missense probably damaging 1.00
R2571:Vit UTSW 17 78586745 missense probably benign
R4011:Vit UTSW 17 78534692 splice site probably benign
R4190:Vit UTSW 17 78586826 missense probably benign 0.13
R4191:Vit UTSW 17 78586826 missense probably benign 0.13
R4192:Vit UTSW 17 78586826 missense probably benign 0.13
R4193:Vit UTSW 17 78586826 missense probably benign 0.13
R4635:Vit UTSW 17 78574212 missense probably benign 0.01
R4705:Vit UTSW 17 78625114 missense probably damaging 1.00
R4841:Vit UTSW 17 78601879 missense probably benign
R4842:Vit UTSW 17 78601879 missense probably benign
R4884:Vit UTSW 17 78624753 missense probably damaging 0.99
R4923:Vit UTSW 17 78586841 missense probably benign 0.03
R5128:Vit UTSW 17 78625146 missense probably damaging 1.00
R5272:Vit UTSW 17 78586835 missense probably benign
R5779:Vit UTSW 17 78546426 missense probably benign
R6596:Vit UTSW 17 78622845 missense probably benign 0.35
R6658:Vit UTSW 17 78622803 missense possibly damaging 0.93
R6792:Vit UTSW 17 78579399 missense probably damaging 1.00
R6894:Vit UTSW 17 78626758 nonsense probably null
R7032:Vit UTSW 17 78624865 missense probably damaging 1.00
R7061:Vit UTSW 17 78625156 missense probably damaging 1.00
R7102:Vit UTSW 17 78624997 missense probably damaging 1.00
R7106:Vit UTSW 17 78586799 missense probably benign
R7292:Vit UTSW 17 78605498 missense probably benign 0.03
R7413:Vit UTSW 17 78624880 missense probably damaging 1.00
X0023:Vit UTSW 17 78566164 missense probably benign
X0064:Vit UTSW 17 78624885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCGTCATCAATTGCGATC -3'
(R):5'- ACATTGTGGCTTGCAGCTAGG -3'

Sequencing Primer
(F):5'- CGTCATCAATTGCGATCTAAAAATAG -3'
(R):5'- TTGCAGCTAGGGGCGCAG -3'
Posted On2014-10-15