Incidental Mutation 'R0164:Ulk3'
ID24046
Institutional Source Beutler Lab
Gene Symbol Ulk3
Ensembl Gene ENSMUSG00000032308
Gene Nameunc-51-like kinase 3
Synonyms
MMRRC Submission 038440-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0164 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location57589452-57596233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57590686 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 90 (I90N)
Ref Sequence ENSEMBL: ENSMUSP00000059947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045791] [ENSMUST00000053230] [ENSMUST00000215748]
Predicted Effect probably benign
Transcript: ENSMUST00000045791
SMART Domains Protein: ENSMUSP00000038350
Gene: ENSMUSG00000040188

DomainStartEndE-ValueType
low complexity region 69 83 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
Pfam:SCAMP 117 293 2.6e-68 PFAM
low complexity region 309 328 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053230
AA Change: I90N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059947
Gene: ENSMUSG00000032308
AA Change: I90N

DomainStartEndE-ValueType
S_TKc 14 270 4.74e-98 SMART
MIT 277 354 1.1e-10 SMART
MIT 372 450 2.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215146
Predicted Effect probably benign
Transcript: ENSMUST00000215748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216667
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217200
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 probably null Het
4930522L14Rik T C 5: 109,736,847 K382E probably damaging Het
Adck1 A G 12: 88,455,510 E297G probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Aldh3a2 C T 11: 61,248,888 V473I probably benign Het
Arfgef3 A T 10: 18,647,915 I369K possibly damaging Het
Atl2 A G 17: 79,853,831 probably benign Het
Atp1b3 T C 9: 96,338,709 I178V possibly damaging Het
Axdnd1 T C 1: 156,378,386 E520G possibly damaging Het
Bahcc1 A T 11: 120,285,074 probably benign Het
BB019430 A T 10: 58,704,271 noncoding transcript Het
BC028528 A T 3: 95,887,334 probably benign Het
Btbd1 T A 7: 81,801,003 Q343L probably benign Het
Catsper1 A G 19: 5,339,475 T473A possibly damaging Het
Chmp6 G A 11: 119,915,523 probably null Het
D130040H23Rik T C 8: 69,302,543 V200A possibly damaging Het
D830013O20Rik C T 12: 73,364,331 noncoding transcript Het
Dcaf1 T A 9: 106,844,145 S379T possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dhx58 T C 11: 100,695,324 I624V probably benign Het
Disp3 T C 4: 148,254,251 E821G probably damaging Het
Dlc1 T A 8: 36,599,440 E464V probably damaging Het
Dnah10 G A 5: 124,783,834 V2151I probably damaging Het
Dnah6 C T 6: 73,188,535 probably benign Het
Dnah8 G A 17: 30,748,665 G2617D probably benign Het
Dnah9 C A 11: 65,918,804 E872* probably null Het
Dock9 T C 14: 121,597,665 Y99C probably damaging Het
Dpy19l3 T A 7: 35,716,646 I310F probably damaging Het
Fggy A T 4: 95,837,654 I137F probably damaging Het
Gli2 A G 1: 118,890,283 probably benign Het
Gm14421 A T 2: 177,056,722 noncoding transcript Het
Gm5689 T A 18: 42,173,543 D58E probably damaging Het
Grin2a A G 16: 9,994,821 probably null Het
Grin2b A G 6: 135,778,648 probably benign Het
Incenp A G 19: 9,894,879 S72P probably benign Het
Ipo11 A G 13: 106,910,194 probably benign Het
Klc3 T A 7: 19,394,926 N469Y possibly damaging Het
Lrrc42 A G 4: 107,247,505 S88P probably benign Het
Lrrc49 G A 9: 60,680,600 T93I probably benign Het
Ltn1 G A 16: 87,405,519 probably benign Het
Mlycd A T 8: 119,407,641 Q294L probably damaging Het
Mmrn1 T A 6: 60,975,815 probably benign Het
Mrpl22 T A 11: 58,171,821 I19N probably benign Het
Msh3 T A 13: 92,349,209 K202N probably damaging Het
N4bp2 T C 5: 65,803,573 probably benign Het
Ncam1 C T 9: 49,568,409 D90N probably damaging Het
Nckap5 A T 1: 126,024,407 D1405E possibly damaging Het
Ncoa2 A G 1: 13,186,731 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp1b A T 11: 71,164,099 W844R probably damaging Het
Nmnat1 G T 4: 149,469,150 N168K possibly damaging Het
Olfr1446 A G 19: 12,890,445 L44P probably damaging Het
Ost4 T C 5: 30,907,459 H26R probably damaging Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Otogl A T 10: 107,874,530 I566N probably damaging Het
Pcyt1a T C 16: 32,470,186 S282P probably damaging Het
Prkcg G A 7: 3,329,119 E581K probably damaging Het
Ralgps2 A G 1: 156,887,089 probably null Het
Rnf157 A G 11: 116,354,810 probably benign Het
Scmh1 T C 4: 120,529,865 probably benign Het
Sgo2b T C 8: 63,938,383 H150R possibly damaging Het
Sh2b3 T G 5: 121,829,037 T5P probably damaging Het
Skint6 A T 4: 112,991,236 probably benign Het
Slfn10-ps T C 11: 83,035,302 noncoding transcript Het
Sspo T A 6: 48,494,194 probably benign Het
Tcp1 T A 17: 12,922,747 probably benign Het
Tdp2 A G 13: 24,838,239 M214V probably damaging Het
Tenm4 T G 7: 96,729,340 probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem204 A G 17: 25,058,350 I187T probably damaging Het
Tmem208 T G 8: 105,334,694 D117E probably benign Het
Tnks1bp1 C T 2: 85,059,221 P631S possibly damaging Het
Tomm70a T C 16: 57,147,821 V517A probably damaging Het
Ttc7 T C 17: 87,379,895 V801A probably damaging Het
Txndc5 A T 13: 38,507,953 C146S probably damaging Het
Ubac2 A G 14: 122,008,917 probably benign Het
Ube4b G T 4: 149,360,324 T493K probably damaging Het
Ufl1 A T 4: 25,256,008 Y504N probably benign Het
Ugt1a6a T C 1: 88,139,270 V266A possibly damaging Het
Ugt1a6b T A 1: 88,107,467 C176S probably damaging Het
Unc13c T C 9: 73,694,892 I1357M probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r114 A G 17: 23,309,826 probably null Het
Vmn2r91 A C 17: 18,106,137 N228T probably benign Het
Wdr43 T G 17: 71,631,997 probably benign Het
Wisp1 T C 15: 66,919,210 L287P probably damaging Het
Zbtb6 G T 2: 37,429,588 Y109* probably null Het
Zfp980 A G 4: 145,701,997 D432G probably benign Het
Other mutations in Ulk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Ulk3 UTSW 9 57590356 nonsense probably null
R0164:Ulk3 UTSW 9 57590686 missense probably damaging 1.00
R0334:Ulk3 UTSW 9 57594227 unclassified probably benign
R0391:Ulk3 UTSW 9 57594832 missense probably benign
R1635:Ulk3 UTSW 9 57593160 critical splice acceptor site probably null
R2696:Ulk3 UTSW 9 57590441 missense possibly damaging 0.63
R3689:Ulk3 UTSW 9 57593794 missense probably benign 0.44
R4151:Ulk3 UTSW 9 57592367 missense possibly damaging 0.64
R4502:Ulk3 UTSW 9 57593229 missense probably damaging 1.00
R4586:Ulk3 UTSW 9 57594310 missense possibly damaging 0.81
R4746:Ulk3 UTSW 9 57592918 missense probably benign
R5034:Ulk3 UTSW 9 57593764 missense possibly damaging 0.88
R5288:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R5385:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R5386:Ulk3 UTSW 9 57590740 missense possibly damaging 0.81
R7480:Ulk3 UTSW 9 57591240 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATTGAGATCCTCAAGGGCATTCGG -3'
(R):5'- TGCTAGGGACACAACATGGCAGAC -3'

Sequencing Primer
(F):5'- ATTCGGCACCCCCATATCG -3'
(R):5'- TGGCAGACTGCAAAGCATTG -3'
Posted On2013-04-16