Incidental Mutation 'R2237:Pdlim2'
ID 240492
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene Name PDZ and LIM domain 2
Synonyms SLIM, 4732462F18Rik, mystique
MMRRC Submission 040237-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R2237 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 70401667-70415130 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 70408698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 173 (T173P)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000153735] [ENSMUST00000143393]
AlphaFold Q8R1G6
Predicted Effect probably benign
Transcript: ENSMUST00000022681
AA Change: T173P

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: T173P

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123125
Predicted Effect probably benign
Transcript: ENSMUST00000125300
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127836
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129174
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect probably benign
Transcript: ENSMUST00000153735
AA Change: T173P

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: T173P

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143393
AA Change: T173P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090
AA Change: T173P

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138792
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 25,136,303 (GRCm39) E406G probably benign Het
Alox8 A C 11: 69,076,597 (GRCm39) S572A probably benign Het
Aoah G A 13: 20,978,481 (GRCm39) probably benign Het
Arhgap36 G T X: 48,582,282 (GRCm39) V60L possibly damaging Het
Arhgef37 T A 18: 61,637,477 (GRCm39) Y395F probably damaging Het
Bard1 G A 1: 71,114,135 (GRCm39) P282L probably damaging Het
Brd7 T A 8: 89,073,541 (GRCm39) E283V probably benign Het
Btbd9 T C 17: 30,553,302 (GRCm39) I387V probably benign Het
Cacna1a T C 8: 85,360,394 (GRCm39) probably null Het
Cacna1c T C 6: 118,629,704 (GRCm39) Q1205R possibly damaging Het
Camsap2 A T 1: 136,273,069 (GRCm39) L36Q probably damaging Het
Ccnj T C 19: 40,834,219 (GRCm39) F261L probably benign Het
Cd200r4 T A 16: 44,641,260 (GRCm39) M1K probably null Het
Cdca7l A G 12: 117,837,761 (GRCm39) E237G probably damaging Het
Cep128 T C 12: 91,314,341 (GRCm39) T146A probably benign Het
Clhc1 T G 11: 29,519,329 (GRCm39) S379A probably benign Het
Dbf4 T A 5: 8,458,542 (GRCm39) I158L possibly damaging Het
Deup1 A C 9: 15,486,597 (GRCm39) I455S probably damaging Het
Dlec1 T C 9: 118,967,259 (GRCm39) probably null Het
Eomes A G 9: 118,311,359 (GRCm39) D394G probably damaging Het
Epn1 A G 7: 5,100,601 (GRCm39) N518S probably damaging Het
Espl1 G A 15: 102,224,004 (GRCm39) R1185H probably damaging Het
Evc2 T C 5: 37,535,527 (GRCm39) S401P probably benign Het
Fbxw15 A G 9: 109,384,303 (GRCm39) S403P probably damaging Het
Hsd17b1 G A 11: 100,970,652 (GRCm39) V236M probably damaging Het
Htatsf1 G T X: 56,111,864 (GRCm39) D642Y unknown Het
Iqca1l A T 5: 24,753,292 (GRCm39) N453K probably benign Het
Itpripl2 T C 7: 118,089,294 (GRCm39) T422A probably benign Het
Izumo4 T C 10: 80,538,664 (GRCm39) S39P probably damaging Het
Kcnh5 T A 12: 75,054,493 (GRCm39) M484L probably benign Het
Kctd8 T A 5: 69,267,752 (GRCm39) I453F probably damaging Het
Kif5c A G 2: 49,584,020 (GRCm39) T152A probably benign Het
Kntc1 T C 5: 123,941,733 (GRCm39) V1809A possibly damaging Het
L3mbtl2 A T 15: 81,568,531 (GRCm39) T512S probably benign Het
Ltbp1 C A 17: 75,617,158 (GRCm39) D1032E probably benign Het
Mindy4 T C 6: 55,278,055 (GRCm39) F633S probably damaging Het
Muc5b T G 7: 141,415,826 (GRCm39) I2924S probably benign Het
Nfe2l2 G A 2: 75,506,898 (GRCm39) P401S probably benign Het
Nid1 T C 13: 13,675,070 (GRCm39) V930A probably benign Het
Nt5c1b C A 12: 10,425,558 (GRCm39) T309K probably damaging Het
Nt5m A G 11: 59,743,696 (GRCm39) K108R probably benign Het
Or10v5 T C 19: 11,805,814 (GRCm39) D192G probably damaging Het
Or13p3 A G 4: 118,567,192 (GRCm39) D196G probably damaging Het
Osbpl9 T A 4: 109,013,854 (GRCm39) Q80L probably damaging Het
Osm A G 11: 4,188,505 (GRCm39) N44S possibly damaging Het
Pclo C T 5: 14,763,952 (GRCm39) P4142S unknown Het
Pex1 T C 5: 3,668,915 (GRCm39) probably null Het
Phka2 A G X: 159,324,408 (GRCm39) E254G probably damaging Het
Pik3cb A G 9: 98,923,081 (GRCm39) Y984H probably damaging Het
Plscr2 T C 9: 92,172,877 (GRCm39) C179R probably damaging Het
Rbpms2 C A 9: 65,558,893 (GRCm39) Y183* probably null Het
Ryr2 T A 13: 11,677,146 (GRCm39) E3235V probably benign Het
Sesn3 T C 9: 14,219,761 (GRCm39) V50A probably benign Het
Siglecf T C 7: 43,004,409 (GRCm39) V246A probably benign Het
Sp2 C T 11: 96,846,762 (GRCm39) C527Y probably damaging Het
Spata31e2 A T 1: 26,724,241 (GRCm39) M313K possibly damaging Het
Spata4 A C 8: 55,055,664 (GRCm39) K185T probably benign Het
Spin2c A G X: 152,616,672 (GRCm39) I162V probably damaging Het
Stac G A 9: 111,519,190 (GRCm39) probably benign Het
Tas1r3 A T 4: 155,946,675 (GRCm39) M310K possibly damaging Het
Tenm3 G A 8: 48,795,372 (GRCm39) P585L probably damaging Het
Tnfsf11 A T 14: 78,537,421 (GRCm39) S81T possibly damaging Het
Topaz1 C T 9: 122,600,212 (GRCm39) T984I probably benign Het
Ttll2 G A 17: 7,619,522 (GRCm39) T135I probably benign Het
Ubr4 A G 4: 139,170,101 (GRCm39) S1584G probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn2r80 G A 10: 79,004,104 (GRCm39) E106K probably damaging Het
Xpc T C 6: 91,475,090 (GRCm39) H643R probably damaging Het
Zan G A 5: 137,456,099 (GRCm39) Q1354* probably null Het
Zpld2 A C 4: 133,929,516 (GRCm39) M263R unknown Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70,403,532 (GRCm39) splice site probably benign
IGL02338:Pdlim2 APN 14 70,411,906 (GRCm39) missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70,411,925 (GRCm39) missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70,403,579 (GRCm39) missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70,411,773 (GRCm39) splice site probably benign
R1595:Pdlim2 UTSW 14 70,402,193 (GRCm39) missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70,408,688 (GRCm39) missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70,411,784 (GRCm39) critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2843:Pdlim2 UTSW 14 70,403,549 (GRCm39) missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70,405,464 (GRCm39) unclassified probably benign
R4971:Pdlim2 UTSW 14 70,405,208 (GRCm39) missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70,405,229 (GRCm39) missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70,405,137 (GRCm39) missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70,411,826 (GRCm39) missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70,403,645 (GRCm39) missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70,408,924 (GRCm39) missense probably benign
R8342:Pdlim2 UTSW 14 70,403,563 (GRCm39) missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign
R9361:Pdlim2 UTSW 14 70,402,190 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTCAGTGTTAGCTAGC -3'
(R):5'- GCCCTTTCTAAAGAGGATATGATTGG -3'

Sequencing Primer
(F):5'- AGCTTCTCTGGCTGGCTCAG -3'
(R):5'- TGGGCCACCAAGTTTGAG -3'
Posted On 2014-10-15