Mutagenetix > Incidental Mutation

Incidental Mutation 'R2237:Espl1'

240496

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

040237-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2237 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 102315569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1185 (R1185H)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably damaging
Transcript: ENSMUST00000064924
AA Change: R1185H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: R1185H

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000229050
AA Change: R1185H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	A	T	1: 26,685,160	M313K	possibly damaging	Het
4931409K22Rik	A	T	5: 24,548,294	N453K	probably benign	Het
Adam18	T	C	8: 24,646,287	E406G	probably benign	Het
Alox8	A	C	11: 69,185,771	S572A	probably benign	Het
Aoah	G	A	13: 20,794,311		probably benign	Het
Arhgap36	G	T	X: 49,493,405	V60L	possibly damaging	Het
Arhgef37	T	A	18: 61,504,406	Y395F	probably damaging	Het
Bard1	G	A	1: 71,074,976	P282L	probably damaging	Het
Brd7	T	A	8: 88,346,913	E283V	probably benign	Het
Btbd9	T	C	17: 30,334,328	I387V	probably benign	Het
Cacna1a	T	C	8: 84,633,765		probably null	Het
Cacna1c	T	C	6: 118,652,743	Q1205R	possibly damaging	Het
Camsap2	A	T	1: 136,345,331	L36Q	probably damaging	Het
Ccnj	T	C	19: 40,845,775	F261L	probably benign	Het
Cd200r4	T	A	16: 44,820,897	M1K	probably null	Het
Cdca7l	A	G	12: 117,874,026	E237G	probably damaging	Het
Cep128	T	C	12: 91,347,567	T146A	probably benign	Het
Clhc1	T	G	11: 29,569,329	S379A	probably benign	Het
Dbf4	T	A	5: 8,408,542	I158L	possibly damaging	Het
Deup1	A	C	9: 15,575,301	I455S	probably damaging	Het
Dlec1	T	C	9: 119,138,191		probably null	Het
Eomes	A	G	9: 118,482,291	D394G	probably damaging	Het
Epn1	A	G	7: 5,097,602	N518S	probably damaging	Het
Evc2	T	C	5: 37,378,183	S401P	probably benign	Het
Fbxw15	A	G	9: 109,555,235	S403P	probably damaging	Het
Gm7534	A	C	4: 134,202,205	M263R	unknown	Het
Hsd17b1	G	A	11: 101,079,826	V236M	probably damaging	Het
Htatsf1	G	T	X: 57,066,504	D642Y	unknown	Het
Itpripl2	T	C	7: 118,490,071	T422A	probably benign	Het
Izumo4	T	C	10: 80,702,830	S39P	probably damaging	Het
Kcnh5	T	A	12: 75,007,719	M484L	probably benign	Het
Kctd8	T	A	5: 69,110,409	I453F	probably damaging	Het
Kif5c	A	G	2: 49,694,008	T152A	probably benign	Het
Kntc1	T	C	5: 123,803,670	V1809A	possibly damaging	Het
L3mbtl2	A	T	15: 81,684,330	T512S	probably benign	Het
Ltbp1	C	A	17: 75,310,163	D1032E	probably benign	Het
Mindy4	T	C	6: 55,301,070	F633S	probably damaging	Het
Muc5b	T	G	7: 141,862,089	I2924S	probably benign	Het
Nfe2l2	G	A	2: 75,676,554	P401S	probably benign	Het
Nid1	T	C	13: 13,500,485	V930A	probably benign	Het
Nt5c1b	C	A	12: 10,375,558	T309K	probably damaging	Het
Nt5m	A	G	11: 59,852,870	K108R	probably benign	Het
Olfr1341	A	G	4: 118,709,995	D196G	probably damaging	Het
Olfr1417	T	C	19: 11,828,450	D192G	probably damaging	Het
Osbpl9	T	A	4: 109,156,657	Q80L	probably damaging	Het
Osm	A	G	11: 4,238,505	N44S	possibly damaging	Het
Pclo	C	T	5: 14,713,938	P4142S	unknown	Het
Pdlim2	T	G	14: 70,171,249	T173P	probably benign	Het
Pex1	T	C	5: 3,618,915		probably null	Het
Phka2	A	G	X: 160,541,412	E254G	probably damaging	Het
Pik3cb	A	G	9: 99,041,028	Y984H	probably damaging	Het
Plscr2	T	C	9: 92,290,824	C179R	probably damaging	Het
Rbpms2	C	A	9: 65,651,611	Y183*	probably null	Het
Ryr2	T	A	13: 11,662,260	E3235V	probably benign	Het
Sesn3	T	C	9: 14,308,465	V50A	probably benign	Het
Siglecf	T	C	7: 43,354,985	V246A	probably benign	Het
Sp2	C	T	11: 96,955,936	C527Y	probably damaging	Het
Spata4	A	C	8: 54,602,629	K185T	probably benign	Het
Spin2c	A	G	X: 153,833,676	I162V	probably damaging	Het
Stac	G	A	9: 111,690,122		probably benign	Het
Tas1r3	A	T	4: 155,862,218	M310K	possibly damaging	Het
Tenm3	G	A	8: 48,342,337	P585L	probably damaging	Het
Tnfsf11	A	T	14: 78,299,981	S81T	possibly damaging	Het
Topaz1	C	T	9: 122,771,147	T984I	probably benign	Het
Ttll2	G	A	17: 7,352,123	T135I	probably benign	Het
Ubr4	A	G	4: 139,442,790	S1584G	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r80	G	A	10: 79,168,270	E106K	probably damaging	Het
Xpc	T	C	6: 91,498,108	H643R	probably damaging	Het
Zan	G	A	5: 137,457,837	Q1354*	probably null	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAACGAACCTGGTCCCATC -3'
(R):5'- TGTTGCCACAAACTTCAGCCC -3'

Sequencing Primer
(F):5'- GGTCCCATCCAGTCCTCTGTAAAC -3'
(R):5'- AACTTCAGCCCCGACGC -3'

Posted On

2014-10-15