Incidental Mutation 'R0164:Dcaf1'
ID24050
Institutional Source Beutler Lab
Gene Symbol Dcaf1
Ensembl Gene ENSMUSG00000040325
Gene NameDDB1 and CUL4 associated factor 1
SynonymsB930007L02Rik, Vprbp
MMRRC Submission 038440-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0164 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location106821874-106880992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106844145 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 379 (S379T)
Ref Sequence ENSEMBL: ENSMUSP00000125730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000159645] [ENSMUST00000161758]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055009
AA Change: S379T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325
AA Change: S379T

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1392 N/A PDB
SCOP:d1tbga_ 1063 1375 9e-20 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1393 1452 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
PDB:4P7I|D 1484 1506 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159645
AA Change: S379T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325
AA Change: S379T

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1394 N/A PDB
SCOP:d1tbga_ 1063 1375 1e-19 SMART
Blast:WD40 1078 1120 2e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1395 1402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161758
AA Change: S379T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325
AA Change: S379T

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1398 N/A PDB
SCOP:d1tbga_ 1063 1308 3e-19 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1399 1458 N/A INTRINSIC
low complexity region 1463 1489 N/A INTRINSIC
PDB:4P7I|D 1490 1512 2e-6 PDB
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 98% (85/87)
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATC GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATC 10: 95,794,578 probably null Het
4930522L14Rik T C 5: 109,736,847 K382E probably damaging Het
Adck1 A G 12: 88,455,510 E297G probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Aldh3a2 C T 11: 61,248,888 V473I probably benign Het
Arfgef3 A T 10: 18,647,915 I369K possibly damaging Het
Atl2 A G 17: 79,853,831 probably benign Het
Atp1b3 T C 9: 96,338,709 I178V possibly damaging Het
Axdnd1 T C 1: 156,378,386 E520G possibly damaging Het
Bahcc1 A T 11: 120,285,074 probably benign Het
BB019430 A T 10: 58,704,271 noncoding transcript Het
BC028528 A T 3: 95,887,334 probably benign Het
Btbd1 T A 7: 81,801,003 Q343L probably benign Het
Catsper1 A G 19: 5,339,475 T473A possibly damaging Het
Chmp6 G A 11: 119,915,523 probably null Het
D130040H23Rik T C 8: 69,302,543 V200A possibly damaging Het
D830013O20Rik C T 12: 73,364,331 noncoding transcript Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dhx58 T C 11: 100,695,324 I624V probably benign Het
Disp3 T C 4: 148,254,251 E821G probably damaging Het
Dlc1 T A 8: 36,599,440 E464V probably damaging Het
Dnah10 G A 5: 124,783,834 V2151I probably damaging Het
Dnah6 C T 6: 73,188,535 probably benign Het
Dnah8 G A 17: 30,748,665 G2617D probably benign Het
Dnah9 C A 11: 65,918,804 E872* probably null Het
Dock9 T C 14: 121,597,665 Y99C probably damaging Het
Dpy19l3 T A 7: 35,716,646 I310F probably damaging Het
Fggy A T 4: 95,837,654 I137F probably damaging Het
Gli2 A G 1: 118,890,283 probably benign Het
Gm14421 A T 2: 177,056,722 noncoding transcript Het
Gm5689 T A 18: 42,173,543 D58E probably damaging Het
Grin2a A G 16: 9,994,821 probably null Het
Grin2b A G 6: 135,778,648 probably benign Het
Incenp A G 19: 9,894,879 S72P probably benign Het
Ipo11 A G 13: 106,910,194 probably benign Het
Klc3 T A 7: 19,394,926 N469Y possibly damaging Het
Lrrc42 A G 4: 107,247,505 S88P probably benign Het
Lrrc49 G A 9: 60,680,600 T93I probably benign Het
Ltn1 G A 16: 87,405,519 probably benign Het
Mlycd A T 8: 119,407,641 Q294L probably damaging Het
Mmrn1 T A 6: 60,975,815 probably benign Het
Mrpl22 T A 11: 58,171,821 I19N probably benign Het
Msh3 T A 13: 92,349,209 K202N probably damaging Het
N4bp2 T C 5: 65,803,573 probably benign Het
Ncam1 C T 9: 49,568,409 D90N probably damaging Het
Nckap5 A T 1: 126,024,407 D1405E possibly damaging Het
Ncoa2 A G 1: 13,186,731 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nlrp1b A T 11: 71,164,099 W844R probably damaging Het
Nmnat1 G T 4: 149,469,150 N168K possibly damaging Het
Olfr1446 A G 19: 12,890,445 L44P probably damaging Het
Ost4 T C 5: 30,907,459 H26R probably damaging Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Otogl A T 10: 107,874,530 I566N probably damaging Het
Pcyt1a T C 16: 32,470,186 S282P probably damaging Het
Prkcg G A 7: 3,329,119 E581K probably damaging Het
Ralgps2 A G 1: 156,887,089 probably null Het
Rnf157 A G 11: 116,354,810 probably benign Het
Scmh1 T C 4: 120,529,865 probably benign Het
Sgo2b T C 8: 63,938,383 H150R possibly damaging Het
Sh2b3 T G 5: 121,829,037 T5P probably damaging Het
Skint6 A T 4: 112,991,236 probably benign Het
Slfn10-ps T C 11: 83,035,302 noncoding transcript Het
Sspo T A 6: 48,494,194 probably benign Het
Tcp1 T A 17: 12,922,747 probably benign Het
Tdp2 A G 13: 24,838,239 M214V probably damaging Het
Tenm4 T G 7: 96,729,340 probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem204 A G 17: 25,058,350 I187T probably damaging Het
Tmem208 T G 8: 105,334,694 D117E probably benign Het
Tnks1bp1 C T 2: 85,059,221 P631S possibly damaging Het
Tomm70a T C 16: 57,147,821 V517A probably damaging Het
Ttc7 T C 17: 87,379,895 V801A probably damaging Het
Txndc5 A T 13: 38,507,953 C146S probably damaging Het
Ubac2 A G 14: 122,008,917 probably benign Het
Ube4b G T 4: 149,360,324 T493K probably damaging Het
Ufl1 A T 4: 25,256,008 Y504N probably benign Het
Ugt1a6a T C 1: 88,139,270 V266A possibly damaging Het
Ugt1a6b T A 1: 88,107,467 C176S probably damaging Het
Ulk3 T A 9: 57,590,686 I90N probably damaging Het
Unc13c T C 9: 73,694,892 I1357M probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r114 A G 17: 23,309,826 probably null Het
Vmn2r91 A C 17: 18,106,137 N228T probably benign Het
Wdr43 T G 17: 71,631,997 probably benign Het
Wisp1 T C 15: 66,919,210 L287P probably damaging Het
Zbtb6 G T 2: 37,429,588 Y109* probably null Het
Zfp980 A G 4: 145,701,997 D432G probably benign Het
Other mutations in Dcaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Dcaf1 APN 9 106858333 missense probably benign 0.45
IGL01314:Dcaf1 APN 9 106834191 missense probably benign 0.07
IGL01395:Dcaf1 APN 9 106858162 missense possibly damaging 0.73
IGL01936:Dcaf1 APN 9 106859601 missense possibly damaging 0.81
IGL02089:Dcaf1 APN 9 106863111 missense probably benign 0.40
IGL02596:Dcaf1 APN 9 106863021 missense probably damaging 1.00
IGL02828:Dcaf1 APN 9 106844302 splice site probably benign
IGL03036:Dcaf1 APN 9 106844140 missense probably damaging 1.00
IGL03327:Dcaf1 APN 9 106858624 missense possibly damaging 0.79
Latte UTSW 9 106846772 nonsense probably null
IGL02799:Dcaf1 UTSW 9 106857940 missense probably benign 0.42
P0023:Dcaf1 UTSW 9 106860451 missense probably benign 0.40
R0087:Dcaf1 UTSW 9 106863089 missense probably damaging 1.00
R0164:Dcaf1 UTSW 9 106844145 missense possibly damaging 0.94
R0562:Dcaf1 UTSW 9 106844122 splice site probably benign
R0690:Dcaf1 UTSW 9 106846649 splice site probably benign
R1373:Dcaf1 UTSW 9 106857880 missense probably benign 0.18
R1508:Dcaf1 UTSW 9 106854177 missense probably damaging 1.00
R1765:Dcaf1 UTSW 9 106864594 missense probably damaging 1.00
R1845:Dcaf1 UTSW 9 106851962 missense probably benign 0.01
R2016:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106839088 missense probably benign 0.41
R2017:Dcaf1 UTSW 9 106847923 missense probably damaging 0.99
R2246:Dcaf1 UTSW 9 106854177 missense possibly damaging 0.94
R2321:Dcaf1 UTSW 9 106838473 missense probably benign 0.04
R4528:Dcaf1 UTSW 9 106844204 missense probably damaging 1.00
R4646:Dcaf1 UTSW 9 106846807 missense probably benign 0.27
R4648:Dcaf1 UTSW 9 106865677 unclassified probably benign
R4742:Dcaf1 UTSW 9 106858555 missense probably benign 0.00
R5876:Dcaf1 UTSW 9 106863650 missense probably damaging 1.00
R5926:Dcaf1 UTSW 9 106838362 missense probably benign 0.02
R6057:Dcaf1 UTSW 9 106854247 missense probably damaging 0.99
R6335:Dcaf1 UTSW 9 106838646 missense possibly damaging 0.63
R6518:Dcaf1 UTSW 9 106835589 missense probably damaging 1.00
R6812:Dcaf1 UTSW 9 106858069 missense probably damaging 1.00
R6829:Dcaf1 UTSW 9 106838604 missense probably damaging 0.97
R6972:Dcaf1 UTSW 9 106846772 nonsense probably null
R7175:Dcaf1 UTSW 9 106858576 missense probably benign 0.32
R7650:Dcaf1 UTSW 9 106838344 missense probably benign 0.01
R7734:Dcaf1 UTSW 9 106838679 missense probably damaging 1.00
X0019:Dcaf1 UTSW 9 106834159 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCGTCATGTTTAGCAAGGCCC -3'
(R):5'- TGTGCTGTTTTAAAGAGATGGTCCCC -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- TTAAAGAGATGGTCCCCATCAAATC -3'
Posted On2013-04-16