Incidental Mutation 'R2239:Gm7534'
ID240527
Institutional Source Beutler Lab
Gene Symbol Gm7534
Ensembl Gene ENSMUSG00000073747
Gene Namepredicted gene 7534
Synonyms
MMRRC Submission 040239-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R2239 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134190804-134203004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 134202205 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 263 (M263R)
Ref Sequence ENSEMBL: ENSMUSP00000095461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097849]
Predicted Effect unknown
Transcript: ENSMUST00000097849
AA Change: M263R
SMART Domains Protein: ENSMUSP00000095461
Gene: ENSMUSG00000073747
AA Change: M263R

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
internal_repeat_1 21 111 5.47e-40 PROSPERO
low complexity region 112 143 N/A INTRINSIC
low complexity region 158 177 N/A INTRINSIC
internal_repeat_1 181 271 5.47e-40 PROSPERO
low complexity region 322 334 N/A INTRINSIC
ZP 368 618 3.21e-13 SMART
low complexity region 650 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122228
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 94% (68/72)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,646,287 E406G probably benign Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm T A 1: 139,456,846 I127K possibly damaging Het
Atp8b3 A G 10: 80,530,988 C259R probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Ccdc47 G T 11: 106,202,134 N100K possibly damaging Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Cnnm4 T A 1: 36,505,678 S673T probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Dars2 T C 1: 161,063,282 T120A possibly damaging Het
Dnah7b C A 1: 46,201,184 probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Exoc1 T C 5: 76,559,710 probably benign Het
Fam186a C T 15: 99,954,864 V158M unknown Het
Fryl A G 5: 73,108,547 L477P probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ift88 A G 14: 57,455,504 I387V probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Map3k1 A C 13: 111,748,944 S1480A probably benign Het
Map7 A T 10: 20,278,282 N715Y unknown Het
Morn4 A G 19: 42,078,032 Y39H possibly damaging Het
Myh14 A T 7: 44,665,183 D105E probably damaging Het
Nfasc T C 1: 132,583,022 probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr205 T A 16: 59,329,375 I45F probably damaging Het
Olfr223 A G 11: 59,589,271 S273P possibly damaging Het
P4hb A G 11: 120,563,282 Y329H probably damaging Het
Papolg A G 11: 23,876,378 Y259H probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Pde4a G A 9: 21,211,268 C820Y probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Phrf1 A G 7: 141,237,692 E138G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc16a8 T C 15: 79,252,947 M88V probably damaging Het
Slc35f4 A G 14: 49,306,203 probably null Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tet1 T C 10: 62,879,734 D94G probably benign Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,576,214 T2020K probably benign Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Gm7534
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Gm7534 APN 4 134201980 missense probably benign 0.27
IGL03170:Gm7534 APN 4 134193034 missense possibly damaging 0.57
FR4342:Gm7534 UTSW 4 134202631 small insertion probably benign
FR4976:Gm7534 UTSW 4 134202630 small insertion probably benign
R0487:Gm7534 UTSW 4 134202778 missense probably damaging 0.97
R0530:Gm7534 UTSW 4 134202910 missense probably benign
R0553:Gm7534 UTSW 4 134202518 missense possibly damaging 0.85
R1121:Gm7534 UTSW 4 134202937 missense probably benign 0.00
R1458:Gm7534 UTSW 4 134196833 missense probably benign 0.01
R1748:Gm7534 UTSW 4 134200299 missense probably damaging 1.00
R1748:Gm7534 UTSW 4 134202119 missense possibly damaging 0.57
R1913:Gm7534 UTSW 4 134192675 critical splice donor site probably null
R2029:Gm7534 UTSW 4 134202358 missense possibly damaging 0.87
R2069:Gm7534 UTSW 4 134201941 missense possibly damaging 0.63
R2237:Gm7534 UTSW 4 134202205 missense unknown
R3943:Gm7534 UTSW 4 134200345 missense probably benign 0.15
R4646:Gm7534 UTSW 4 134202148 missense probably benign 0.00
R4673:Gm7534 UTSW 4 134200347 missense probably benign 0.01
R4838:Gm7534 UTSW 4 134193099 missense probably benign 0.04
R5002:Gm7534 UTSW 4 134196920 missense probably benign 0.09
R5593:Gm7534 UTSW 4 134193039 missense probably damaging 0.99
R5606:Gm7534 UTSW 4 134200212 missense probably benign 0.13
R6553:Gm7534 UTSW 4 134202056 missense probably damaging 0.99
R6834:Gm7534 UTSW 4 134193165 missense possibly damaging 0.95
R6931:Gm7534 UTSW 4 134193153 missense probably benign 0.28
R7526:Gm7534 UTSW 4 134200073 intron probably null
R7771:Gm7534 UTSW 4 134195443 missense probably benign 0.01
RF015:Gm7534 UTSW 4 134193027 missense probably benign
T0975:Gm7534 UTSW 4 134202629 small insertion probably benign
Z1176:Gm7534 UTSW 4 134200338 missense possibly damaging 0.90
Z1176:Gm7534 UTSW 4 134202677 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGTCCCGATCATAGTGG -3'
(R):5'- CTGTCATCTGGAACTGGGATAC -3'

Sequencing Primer
(F):5'- CCCGATCATAGTGGAGGATTTG -3'
(R):5'- CCGTGCCTGAGAAGTTAACTC -3'
Posted On2014-10-15